Package {TmCalculator}


Type: Package
Title: Genome-Wide Nucleic Acid Melting Temperature Profiling and Multi-Omics Integration
Version: 1.1.1
Date: 2026-09-21
Description: Accurate calculation of nucleic acid melting temperature (Tm) is fundamental to many molecular biology applications, and this software scales Tm analysis from individual sequences to genome‑wide thermodynamic profiling. This package extends Tm analysis from simple sequence level computation to comprehensive genome-wide thermodynamic profiling. It takes four input sources: sequence strings, a FASTA file, an installed 'BSgenome' package named by string, or a 'GRanges' carrying sequences. A 'regions' argument selects what to cover and 'window' and 'slide' set the resolution at which it is tiled. The implementation provides three Tm calculation methods: the Wallace rule (Thein & Wallace, 1986), empirical GC‑content formulas (Marmur, 1962; Schildkraut, 2010; Wetmur, 1991; Untergasser, 2012; von Ahsen, 2001), and nearest‑neighbor thermodynamics (Breslauer, 1986; Sugimoto, 1996; Allawi, 1998; SantaLucia, 2004; Freier, 1986; Xia, 1998; Chen, 2012; Bommarito, 2000; Turner, 2010; Sugimoto, 1995; Allawi, 1997; SantaLucia, 2005; Zuber, 2022; Ghosh, 2020, 2023). Nearest-neighbor parameter sets are provided for DNA, RNA and RNA/DNA hybrid duplexes. These include sets obtained by melting-temperature optimization that are fitted directly at a stated sodium concentration (Weber, 2015; Ferreira, 2019; Basilio Barbosa, 2019; Banerjee, 2020), which replace salt correction rather than being corrected; salt correction is skipped automatically when the requested condition matches the one a set was fitted at. The Zuber (2022) set additionally replaces the single terminal-AU penalty with end terms that depend on the penultimate base pair, applied automatically at both duplex ends. Parameter sets measured under molecular crowding (Ghosh, 2020, 2023) are also provided for DNA and RNA duplexes, so that duplex stability can be evaluated under cell-like rather than dilute-solution conditions. Corrections are otherwise supported for salt ions (SantaLucia, 1996, 1998; Owczarzy, 2004, 2008) and for chemical conditions such as dimethyl sulfoxide and formamide. A compiled C++ core, and task partitioning by region across 'BiocParallel' workers through a 'BPPARAM' argument, profile the human genome in 3 minutes on a six-core laptop. This package returns result as a GRanges object for interoperability with Bioconductor workflows and downstream multi-omics analyses. Data-level integration reconciles Tm windows with external multi-omics GRanges objects through overlap, nearest-feature, windowed-count, and binned-average strategies, returning a single unified GRanges object ready for downstream analysis. Visualization-level integration renders multiple feature layers as independent concentric tracks on a shared genomic axis, each retaining its native coordinate resolution. Group comparison supports Wilcoxon rank-sum and Student's t-tests with multiple available correction methods for contrasting Tm and other features across region classes.
BugReports: https://github.com/JunhuiLi1017/TmCalculator/issues
License: MIT + file LICENSE
Depends: R (≥ 3.5)
VignetteBuilder: knitr
Imports: BiocGenerics, Biostrings, GenomeInfoDb, GenomicRanges, BiocParallel, IRanges, Rcpp, S4Vectors, graphics, grDevices, methods
LinkingTo: Rcpp
Suggests: BSgenome, testthat (≥ 3.0.0), knitr, rmarkdown, remotes, BiocManager, BSgenomeForge, karyoploteR, ggplot2, ggridges, ggforce, ps
NeedsCompilation: yes
Repository: CRAN
RoxygenNote: 7.3.2
LazyData: true
LazyDataCompression: xz
Encoding: UTF-8
Packaged: 2026-09-21 20:29:36 UTC; lij11
Author: Junhui Li ORCID iD [cre, aut], Lihua Julie Zhu ORCID iD [aut]
Maintainer: Junhui Li <ljh.biostat@gmail.com>
Date/Publication: 2026-09-21 21:50:09 UTC

TmCalculator: Genome-Wide Nucleic Acid Melting Temperature Profiling and Multi-Omics Integration

Description

logo

Accurate calculation of nucleic acid melting temperature (Tm) is fundamental to many molecular biology applications, and this software scales Tm analysis from individual sequences to genome‑wide thermodynamic profiling. This package extends Tm analysis from simple sequence level computation to comprehensive genome-wide thermodynamic profiling. It takes four input sources: sequence strings, a FASTA file, an installed 'BSgenome' package named by string, or a 'GRanges' carrying sequences. A 'regions' argument selects what to cover and 'window' and 'slide' set the resolution at which it is tiled. The implementation provides three Tm calculation methods: the Wallace rule (Thein & Wallace, 1986), empirical GC‑content formulas (Marmur, 1962; Schildkraut, 2010; Wetmur, 1991; Untergasser, 2012; von Ahsen, 2001), and nearest‑neighbor thermodynamics (Breslauer, 1986; Sugimoto, 1996; Allawi, 1998; SantaLucia, 2004; Freier, 1986; Xia, 1998; Chen, 2012; Bommarito, 2000; Turner, 2010; Sugimoto, 1995; Allawi, 1997; SantaLucia, 2005; Zuber, 2022; Ghosh, 2020, 2023). Nearest-neighbor parameter sets are provided for DNA, RNA and RNA/DNA hybrid duplexes. These include sets obtained by melting-temperature optimization that are fitted directly at a stated sodium concentration (Weber, 2015; Ferreira, 2019; Basilio Barbosa, 2019; Banerjee, 2020), which replace salt correction rather than being corrected; salt correction is skipped automatically when the requested condition matches the one a set was fitted at. The Zuber (2022) set additionally replaces the single terminal-AU penalty with end terms that depend on the penultimate base pair, applied automatically at both duplex ends. Parameter sets measured under molecular crowding (Ghosh, 2020, 2023) are also provided for DNA and RNA duplexes, so that duplex stability can be evaluated under cell-like rather than dilute-solution conditions. Corrections are otherwise supported for salt ions (SantaLucia, 1996, 1998; Owczarzy, 2004, 2008) and for chemical conditions such as dimethyl sulfoxide and formamide. A compiled C++ core, and task partitioning by region across 'BiocParallel' workers through a 'BPPARAM' argument, profile the human genome in 3 minutes on a six-core laptop. This package returns result as a GRanges object for interoperability with Bioconductor workflows and downstream multi-omics analyses. Data-level integration reconciles Tm windows with external multi-omics GRanges objects through overlap, nearest-feature, windowed-count, and binned-average strategies, returning a single unified GRanges object ready for downstream analysis. Visualization-level integration renders multiple feature layers as independent concentric tracks on a shared genomic axis, each retaining its native coordinate resolution. Group comparison supports Wilcoxon rank-sum and Student's t-tests with multiple available correction methods for contrasting Tm and other features across region classes.

Author(s)

Maintainer: Junhui Li ljh.biostat@gmail.com (ORCID)

Authors:

See Also

Useful links:


Lazy $df accessor for TmCalculator objects

Description

result$df is computed on demand from result$gr instead of being stored eagerly, so genome-scale results are not converted to a data.frame unless actually requested. All other elements behave as plain list access.

Usage

## S3 method for class 'TmCalculator'
x$name

Arguments

x

A TmCalculator object.

name

Element name.

Value

The element, or a data.frame built from x$gr when name == "df" and no stored df exists.


Vectorized chemical correction over per-sequence GC percent

Description

Mirrors chem_correct() exactly (including argument validation) but accepts a vector of GC percentages, returning one correction per sequence. Used by the Rcpp-backed tm_nn path.

Usage

.chem_correct_vec(
  DMSO = 0,
  formamide_unit = list(value = 0, unit = "percent"),
  dmso_factor = 0.75,
  formamide_factor = 0.65,
  pt_gc = NULL
)

Record lengths of a FASTA file, without reading the sequences

Description

Record lengths of a FASTA file, without reading the sequences

Usage

.fasta_lengths(path)

Arguments

path

Path to a FASTA file, optionally gzipped.

Value

A named numeric vector of record lengths.


Filter windows with too many N bases

Description

Reads each window sequence and drops those where the N fraction exceeds max_N_frac. Uses batched getSeq for efficiency.

Usage

.filter_N_windows(bsgenome, chr, win_starts, win_ends, max_N_frac, window)

Detect the first and last non-N positions on a chromosome

Description

Uses a coarse block scan to find the positions of the first and last non-N base on a chromosome. Efficient because it only reads N_scan_block bp at a time from each end.

Usage

.find_N_bounds(bsgenome, chr, chr_start, chr_end, block_size)

Vectorized GC percent over a character vector of sequences

Description

Mirrors gc_content() exactly, including its ambiguity apportioning and its GC/(A+C+G+T) denominator, but counts every base in a single compiled pass per sequence (cpp_base_counts()) instead of splitting each sequence into a character vector with s2c() and scanning it five times. The apportioning arithmetic stays here, vectorised over the count matrix, so the published formula remains the readable one.

Usage

.gc_vec(input_seq, ambiguous = FALSE)

Arguments

input_seq

Character vector of sequences.

ambiguous

Logical; apportion ambiguous IUPAC codes as gc_content() does.

Value

Numeric vector of GC percentages, NA where a sequence is NA or contains no countable base.


Load the BSgenome object from an installed BSgenome.* data package

Description

The genome object name is given by the BSgenomeObjname field in DESCRIPTION (e.g. Hsapiens), not necessarily the package name.

Usage

.get_bsgenome_from_pkg(pkg)

Arguments

pkg

Character scalar: installed BSgenome package name.

Value

A BSgenome object.


Sequence extraction by preloading whole chromosomes

Description

Sequence extraction by preloading whole chromosomes

Usage

.getseq_preload_chr(gr_query, genome_objs, parsed)

Arguments

gr_query

Query GRanges.

genome_objs

Named list of BSgenome objects.

parsed

Parsed coordinate data frame.

Value

DNAStringSet of extracted sequences.


Vectorized sequence extraction with getSeq

Description

Vectorized sequence extraction with getSeq

Usage

.getseq_vectorized(gr_query, genome_objs, parsed)

Arguments

gr_query

Query GRanges.

genome_objs

Named list of BSgenome objects.

parsed

Parsed coordinate data frame.

Value

DNAStringSet of extracted sequences.


Load installed BSgenome packages

Description

Load installed BSgenome packages

Usage

.load_genome_packages(pkg_names)

Arguments

pkg_names

Character vector of BSgenome package names.

Value

Named list of genome objects.


Normalize Tm/GC metadata column names on a GRanges object

Description

Renames legacy lowercase tm/gc columns to Tm/GC.

Usage

.normalize_tm_gc_metadata(gr)

Parse coordinate strings into a data frame

Description

Parse coordinate strings into a data frame

Usage

.parse_coord_strings(coord_vec, pkg_name_override = NULL)

Arguments

coord_vec

Character vector of colon-separated coordinate strings.

pkg_name_override

Optional BSgenome package name for 4-field strings.

Value

Data frame with columns chr, win_start, win_end, strand, pkg_name, and region_id.


Vectorized salt correction over per-sequence GC percent and length

Description

Mirrors salt_correct() exactly, but takes precomputed per-sequence GC percent (gc_content() semantics: GC/(A+C+G+T)) and sequence lengths instead of sequences, so one call covers a whole chunk. Used by the Rcpp-backed tm_nn path.

Usage

.salt_correct_vec(Na, K, Tris, Mg, dNTPs, method, gc_pct, seq_len)

Stage sequences as a FASTA file so that workers read rather than receive them

Description

Written in blocks: an XStringSet over the whole vector would double peak memory at exactly the input size where this path is worth using. The record name carries the input position, so a sequence dropped later for containing N can still be identified.

Usage

.spill_fasta(seqs, tmpdir = tempdir())

Arguments

seqs

Character vector of sequences.

tmpdir

Directory for the file.

Value

The path, carrying the input count and names as attributes.


Read 'regions' as an interval query against a GRanges source

Description

"chr1" means the whole of that seqname and "chr1:1000-2000" means that interval of it. A vector of bare integers is positional instead, the nth ranges, which is what the same input means for a FASTA file or for sequences; NULL is returned in that case so the caller resolves it by position.

Usage

.tm_as_granges(regions, src)

Arguments

regions

Character or numeric regions.

src

A GRanges source from .tm_source.

Value

A GRanges to overlap against, or NULL for positional.


Fill in a GRanges that carries sequences but not their complements

Description

Every other input form reaches to_genomic_ranges, which derives the complement. A GRanges handed straight to tm_calculate skipped that step, so an object built with a sequence column and nothing else (which is exactly what regions treats as a source) reached the compiled core with some sequences and no complements and failed there, on a message about cseqs that says nothing about what the caller did.

Usage

.tm_complete_gr(gr)

Arguments

gr

A GRanges.

Details

The complement is the plain base-for-base one, not the reverse complement: tm_nn() reads the two strands in register, so reversing one would pair every position with the wrong partner.

Value

The same object, with a complement column.


Compute Tm for one task's windows

Description

Compute Tm for one task's windows

Usage

.tm_finish(gr, keep_sequence, model)

Arguments

gr

Windows with sequences.

keep_sequence

Keep the sequence columns.

model

Model arguments for tm_calculate.

Value

A GRanges.


Resolve one identifier against a source's own names

Description

Names first, then position. On a BSgenome the chr prefix is added or removed as the genome requires, since that is a naming convention rather than information; FASTA records and seqnames are matched exactly, because theirs are arbitrary and guessing could match the wrong one.

Usage

.tm_match(x, available, src)

Arguments

x

Identifiers to resolve.

available

The source's names, possibly empty strings.

src

The source, used for its kind and for error messages.

Value

Integer positions into available.


Apply the selected model to windows that already carry their sequence

Description

The method dispatch that used to be the whole of tm_calculate(). It is separate now because both routes through the function end here: the direct one, and every task of the profiling one.

Usage

.tm_model(gr, model)

Arguments

gr

Windows with sequence and complement columns.

model

Model arguments, as assembled by tm_calculate.

Value

A TmCalculator object.


Where a source's records sit in the coordinate system the caller cares about

Description

Staging a GRanges to a FASTA turns each range into a record that starts at 1, so without this the profile of a range at chr1:1001-1060 would come back as chr1:1-60. Every other source already numbers from the coordinate the caller asked about, so its offset is zero.

Usage

.tm_offsets(idx, src)

Arguments

idx

Row indices into the source.

src

A source from .tm_source.

Value

A numeric vector of offsets to add to record-relative positions.


Resolve 'regions' against a source

Description

Accepts names, numbers, "name:start-end" strings, a mixture, or a GRanges. Returns one row per requested region, in source order. An unresolvable name or an out-of-bounds coordinate is an error rather than a silent drop: quietly skipping a region would return a profile that is short by that region with nothing to say so.

Usage

.tm_regions(regions, src)

Arguments

regions

The user's regions argument, or NULL for all.

src

A source from .tm_source.

Value

A data frame with idx, name, start, end, whole.


Run the tasks and reassemble one profile

Description

Each task opens the source itself, so what crosses between processes is a name and a coordinate pair rather than any sequence. That is what makes parallelism pay here, and why an in-memory source is staged to a file first rather than sent over a socket.

Usage

.tm_run(tasks, src, window, slide, model, BPPARAM, keep_sequence, verbose)

Arguments

tasks

From .tm_tasks.

src

A source from .tm_source.

window, slide

Tiling; NULL window means one window per region.

model

Model arguments to hand to tm_calculate.

BPPARAM

A BiocParallelParam, or NULL for this process.

keep_sequence

Keep the sequence columns in the result.

verbose

Report task and window counts.

Value

A GRanges in source order.


Classify the input and describe what it offers

Description

Classify the input and describe what it offers

Usage

.tm_source(x, complement_seq = NULL)

Arguments

x

The user's input_seq.

complement_seq

Passed through to to_genomic_ranges when x is a character vector or a file.

Value

A list with kind, the reference needed to reopen the source (pkg, path or gr), and lens, the length of every chromosome, record or range it contains.


One task against a BSgenome

Description

One task against a BSgenome

Usage

.tm_task_bsgenome(task, src, window, slide, keep_sequence, model)

Arguments

task

A task from .tm_tasks.

src

BSgenome package name.

window, slide, keep_sequence, model

As in .tm_run.

Value

A GRanges.


One task against a FASTA file

Description

Reads only its own records, with skip and nrec, so the sequence never travels between processes.

Usage

.tm_task_fasta(task, src, window, slide, keep_sequence, model)

Arguments

task

A task from .tm_tasks.

src

BSgenome package name.

window, slide, keep_sequence, model

As in .tm_run.

Value

A GRanges.


Cut the requested regions into tasks

Description

One task is what a single worker owns from start to finish. Long regions are split into segment_size pieces; short whole records are merged, because reading record n of a file means skipping the first n - 1, so a task per record would rescan the file once per record.

Usage

.tm_tasks(req, src, unit, segment_size, step)

Arguments

req

Regions from .tm_regions.

src

A source from .tm_source.

unit, segment_size, step

Task granularity.

Value

A list of tasks.


Filter invalid bases in nucleotide sequences

Description

This function processes nucleotide sequences by converting characters to uppercase and replacing invalid bases with "". based on the specified method. The function preserves the sequence length and attributes (name and Tm) of each sequence.

Usage

check_filter_seq(seq_list, method)

Arguments

seq_list

Input sequence in 5' to 3' direction. Must be provided as: - A list of sequences with attributes (name and Tm)

method

Method to determine valid bases:

TM_Wallace: Valid bases are "A","B","C","D","G","H","I","K","M","N","R","S","T","V","W" and "Y"

TM_GC: Valid bases are "A","B","C","D","G","H","I","K","M","N","R","S","T","V","W", "X" and "Y"

TM_NN: Valid bases are "A","C","G","I" and "T"

Value

Returns a list of sequences with the same structure as input, where invalid bases are replaced with ""

Author(s)

Junhui Li

References

citation("TmCalculator")


Corrections of melting temperature with chemical substances

Description

Apply corrections to melting temperature calculations based on the presence of DMSO and formamide. These corrections are rough approximations and should be used with caution.

Usage

chem_correct(
  DMSO = 0,
  formamide_unit = list(value = 0, unit = "percent"),
  dmso_factor = 0.75,
  formamide_factor = 0.65,
  pt_gc = NULL
)

Arguments

DMSO

Percent DMSO concentration in the reaction mixture. Default: 0 DMSO can lower the melting temperature of nucleic acid duplexes.

formamide_unit

A list containing formamide concentration information: - value: numeric value of formamide concentration - unit: character string specifying the unit ("percent" or "molar") Default: list(value=0, unit="percent")

dmso_factor

Coefficient of melting temperature (Tm) decrease per percent DMSO. Default: 0.75 (von Ahsen N, 2001, PMID:11673362) Other published values: 0.5, 0.6, 0.675

formamide_factor

Coefficient of melting temperature (Tm) decrease per percent formamide. Default: 0.65 Literature reports values ranging from 0.6 to 0.72

pt_gc

Percentage of GC content in the sequence (0-100 This is used in molar formamide corrections.

Details

When formamide_unit$unit = "percent": Correction = - factor * percentage_of_formamide

When formamide_unit$unit = "molar": Correction = (0.453 * GC/100 - 2.88) * formamide

Author(s)

Junhui Li

References

von Ahsen N, Wittwer CT, Schutz E, et al. Oligonucleotide melting temperatures under PCR conditions: deoxynucleotide Triphosphate and Dimethyl sulfoxide concentrations with comparison to alternative empirical formulas. Clin Chem 2001, 47:1956-1961.

Examples

# DMSO correction
chem_correct(DMSO = 3)

# Formamide correction (percent)
chem_correct(formamide_unit = list(value = 1.25, unit = "percent"), pt_gc = 50)

# Formamide correction (molar)
chem_correct(formamide_unit = list(value = 1.25, unit = "molar"), pt_gc = 50)


Compare numeric GRanges metadata across groups

Description

Test whether one or more numeric metadata columns (e.g. Tm, GC) differ between levels of a categorical grouping column in a GRanges object.

Usage

compare_groups(
  gr,
  target = "Tm",
  method = c("wilcoxon", "t.test"),
  group,
  min_n_per_group = 2L,
  paired = FALSE,
  alternative = c("two.sided", "less", "greater"),
  posthoc = TRUE,
  p.adjust.method = c("holm", "hochberg", "hommel", "bonferroni", "BH", "BY", "fdr",
    "none")
)

Arguments

gr

A GRanges object.

target

Character vector of metadata column names to test (e.g. c("Tm", "GC")). All must be numeric.

method

Statistical test family. One of:

  • "wilcoxon": rank-based tests (Wilcoxon / Kruskal-Wallis).

  • "t.test": Gaussian-based tests (t-test / ANOVA).

group

Character. Name of a metadata column in gr defining groups.

min_n_per_group

Minimum number of non-missing observations required per group. Default: 2.

paired

Logical. Only for exactly two groups. Default: FALSE.

alternative

Character. Alternative hypothesis for two-group tests. One of "two.sided" (default), "less", or "greater".

posthoc

Logical. For \ge 3 groups, run pairwise follow-up tests with multiple-testing correction. Default: TRUE.

p.adjust.method

Multiple-testing correction for post-hoc pairwise comparisons. Passed to pairwise.wilcox.test / pairwise.t.test. One of: "holm" (default), "hochberg", "hommel", "bonferroni", "BH" (Benjamini-Hochberg FDR), "BY" (Benjamini-Yekutieli), "fdr" (alias of "BH"), or "none".

Details

The test used depends on method and the number of group levels:

Groups method = "wilcoxon" method = "t.test"
2 Wilcoxon rank-sum (or signed-rank if paired = TRUE) Welch two-sample t-test (or paired t-test)
\ge 3 Kruskal-Wallis One-way ANOVA (Welch)

When there are three or more groups and posthoc = TRUE, pairwise follow-up tests are run (Wilcoxon or Welch t-test) with p.adjust multiple-testing correction.

Value

A list with:

results

Data frame with one row per target: omnibus test name, statistic, p.value, and group information.

summary

Per-group descriptive statistics (n, mean, sd, median).

pairwise

Pairwise comparisons when posthoc = TRUE and there are \ge 3 groups; otherwise NULL.

Author(s)

Junhui Li

Examples

## Not run: 
library(GenomicRanges)
set.seed(1)
gr <- GRanges(
  seqnames = rep("chr1", 90),
  ranges = IRanges(start = sort(sample(1e6, 90)), width = 50),
  Tm = c(rnorm(30, 74, 2), rnorm(30, 70, 2), rnorm(30, 66, 2)),
  GC = runif(90, 40, 60)
)
gr$group <- rep(c("high", "mid", "low"), each = 30)

# Two groups
gr2 <- gr[gr$group %in% c("high", "low")]
compare_groups(gr2, target = "Tm", group = "group", posthoc = FALSE)

# Three or more groups (Kruskal-Wallis + pairwise Wilcoxon)
compare_groups(gr, target = c("Tm", "GC"), group = "group",
                     method = "wilcoxon")

# Three or more groups (one-way ANOVA + pairwise t-tests)
compare_groups(gr, target = "Tm", group = "group", method = "t.test")

# Post-hoc with Benjamini-Hochberg FDR control
compare_groups(gr, target = "Tm", group = "group",
                     p.adjust.method = "BH")

## End(Not run)


Fast complement and reverse complement

Description

Uses chartr() instead of character-by-character translation. ~10x faster than the seqinr-style implementation for long sequences.

Usage

complement_fast(seq_str, rev = FALSE)

Arguments

seq_str

Character string or vector.

rev

Logical. Return reverse complement? Default FALSE.

Value

Character string(s) with complement.


Convert genomic coordinate strings to a GRanges object

Description

Fast conversion of genomic coordinate strings to a GRanges object with reference sequences fetched from installed BSgenome.* packages. Designed for large sliding-window inputs: genome packages are loaded once, coordinate strings are parsed in one pass, and sequences are extracted with vectorized getSeq (or optional chromosome preloading).

Usage

coor_to_genomic_ranges(
  input,
  complement_seq = NULL,
  method = c("vectorized", "preload_chr")
)

Arguments

input

Coordinate input. Either:

  • A list with pkg_name (BSgenome package name) and seq (character vector of coordinate strings). Preferred for many windows on the same genome.

  • A plain character vector of coordinate strings (legacy format; genome package name is read from field 4 when present).

Supported colon-separated formats:

  • chr:start-end:strand:region_id - requires pkg_name in the input list.

  • chr:start-end:strand:pkg_name:region_id - as produced by make_genomiccoord.

complement_seq

Optional complement coordinates in the same format as input$seq. When NULL, complements are generated automatically from sequence.

method

Sequence extraction strategy:

"vectorized"

One getSeq() call per genome package (default). Best when windows are scattered across many chromosomes.

"preload_chr"

Load each chromosome once and extract all of its windows in a single extractAt() call. Recommended for dense tiling of one or a few chromosomes (e.g. genome-wide sliding windows), where it is several times faster than getSeq(); holds one chromosome in memory at a time. A BSgenome caches the sequences it has loaded, so a second call for the same chromosome does not read it again.

Details

For genome-wide tiling with thousands of windows, pass coordinates as list(pkg_name = "BSgenome.Hsapiens.UCSC.hg38", seq = ...) so the genome package is loaded once instead of per interval.

Value

A GRanges object with metadata columns:

sequence

Reference sequence for each interval.

complement

Complementary sequence.

GC

GC percentage (0-100) per interval, computed as 100 * (G+C)/(A+C+G+T) so that N is excluded from the denominator.

region_id

Region identifier from the coordinate string.

genome_pkg

BSgenome package name used.

Author(s)

Junhui Li

See Also

to_genomic_ranges, to_genomic_ranges_fast

Examples

## Not run: 
coords <- c(
  "chr1:1000-1199:+:win1",
  "chr1:1200-1399:+:win2"
)
gr <- coor_to_genomic_ranges(
  list(pkg_name = "BSgenome.Hsapiens.UCSC.hg38", seq = coords)
)
gr

## End(Not run)


E. coli K-12 MG1655 replication-associated hotspot annotations

Description

A named list of genomic feature tables for *Escherichia coli* K-12 MG1655 (NCBI assembly GCF_000005845.2 / ASM584v2, chromosome U00096.3). The data support the genome-wide Tm vignette and plot_genome_track examples by providing independent multi-omics layers that can be overlaid on the same genomic axis alongside Tm profiles computed with tm_calculate.

Usage

ecoli_rep_hotspots

Format

A named list with five elements:

all_peaks_IP_mutH

A data frame (38 rows) of MutL protein ChIP-seq peaks marking mismatch-repair-associated regions (MutL-AR). Columns: chr, start, end, Sample, name, Size.

bins_rep

A data frame (4,642 rows) of tandem-repeat (microsatellite) counts in non-overlapping 1 kb bins. Columns: chr, start, end, count.

bins_cru

A data frame (4,642 rows) of cruciform-forming sequence counts in non-overlapping 1 kb bins. Columns: chr, start, end, count.

ssdna

A data frame (2,636 rows) of single-stranded DNA regions. Columns: chr, start, end, Cells..strand., Region.

bins_gatc

A data frame (4,642 rows) of GATC methylation-site counts in non-overlapping 1 kb bins. Columns: chr, start, end, count.

All coordinate-based tables use chr = "U00096.3" and are compatible with plot_genome_track and compare_groups.

Source

Curated from published *E. coli* K-12 MG1655 multi-omics datasets used in the package vignette vignette("genome_wide_tm_ecoli", package = "TmCalculator").

Examples

data(ecoli_rep_hotspots)
names(ecoli_rep_hotspots)

# MutL-AR peak coordinates
head(ecoli_rep_hotspots$all_peaks_IP_mutH)

# Microsatellite density in 1 kb bins
summary(ecoli_rep_hotspots$bins_rep$count)

Convert FASTA file to GenomicRanges object

Description

This function reads sequences from a FASTA file and converts them to a GenomicRanges object. If named with format ">chr2:1-10:[+|-]:[seq_name]", the name will be parsed into GRanges components.

Usage

fa_to_genomic_ranges(input_seq)

Arguments

input_seq

Path to the input FASTA file

Value

A GenomicRanges object containing: - GRanges information (seqnames, ranges, strand) - sequence data from FASTA file - Complementary sequences (if provided) - Names from FASTA headers

Examples

# Example with single FASTA file
input_seq <- system.file("extdata", "example1.fasta", package = "TmCalculator")
gr <- fa_to_genomic_ranges(input_seq)


Calculate G and C content of nucleotide sequences

Description

Calculate G and C content of nucleotide sequences. The function calculates the percentage of G and C bases relative to the total number of A, T, G, and C bases in the sequence.

Usage

gc_content(input_seq, ambiguous = FALSE)

Arguments

input_seq

Sequence (5' to 3') of one strand of the nucleic acid duplex. Can be provided as either: - A character string (e.g., "ATGCG") - A path to a FASTA file containing the sequence(s)

ambiguous

Logical. If TRUE, ambiguous bases are taken into account when computing the G and C content. The function handles various ambiguous bases (S, W, M, K, R, Y, V, H, D, B) by proportionally distributing their contribution to GC content based on their possible nucleotide compositions. For example: - S (G or C) contributes fully to GC content - W (A or T) contributes fully to AT content - M (A or C) contributes proportionally based on the ratio of A to C in the sequence - And so on for other ambiguous bases

Value

Content of G and C as a percentage (range from 0 to 100

Author(s)

Junhui Li

Examples


# Calculate GC content of a DNA sequence
gc_content(c("a","t","c","t","g","g","g","c","c","a","g","t","a"))  # 53.85%

# Calculate GC content including ambiguous bases
gc_content("GCATSWSYK", ambiguous = TRUE)  # 55.56%


Generate complementary sequence

Description

Generate the complementary sequence of a nucleic acid sequence, with an option to reverse it.

Usage

generate_complement(input_seq, reverse = FALSE)

Arguments

input_seq

Input sequence(s) in 5' to 3' direction. Must be provided as either: - A character string (e.g., c("ATGCG", "GCTAG"))

reverse

Logical. If TRUE, the complementary sequence is reversed (3' to 5'). If FALSE (default), the complementary sequence is in the same direction (5' to 3').

Value

Returns the complementary sequence(s) in the specified direction.

Author(s)

Junhui Li

References

citation("TmCalculator")

Examples


# Generate complementary sequence in same direction (5' to 3')
generate_complement("ATGCG", reverse = FALSE)

# Generate complementary sequence in reverse direction (3' to 5')
generate_complement("ATGCG", reverse = TRUE)


Integrate a Tm GRanges with multi-omic feature ranges

Description

Combines the output of tm_calculate (a GRanges object with Tm and GC columns) with a second GRanges carrying arbitrary multi-omic metadata (ChIP-seq peaks, ATAC-seq signal, methylation sites, gene annotations, etc.) using one of four positional strategies:

"overlap"

Each tm range is annotated with the aggregated metadata of all feature ranges it directly overlaps.

"nearest"

Each tm range is annotated with the metadata of its single closest feature range, plus an added distance column.

"window"

Each tm range is expanded symmetrically by window_size bp and annotated with aggregated metadata from all features that fall within the expanded window.

"bin"

The genomic space covered by the data is tiled into equal-width bins. Each bin is annotated with the mean tm / GC of overlapping tm ranges and the aggregated feature values - suitable for joint heatmaps and genome-wide correlation analyses.

For strategies "overlap" and "window", when a single Tm range matches multiple features the default behaviour is to summarise: numeric columns are aggregated via agg_fun (default mean), and categorical columns are collapsed to a comma-separated string of unique values.

Usage

integrate_granges(
  gr_tm,
  gr_features,
  strategy = c("overlap", "nearest", "window", "bin"),
  feature_cols = NULL,
  prefix = "",
  window_size = 1000L,
  bin_size = 1e+06,
  agg_fun = mean,
  weight = c("none", "overlap"),
  report_coverage = FALSE,
  min_overlap = 1L,
  ignore_strand = TRUE,
  keep_unmatched = TRUE,
  distance_col = "distance_to_feature"
)

Arguments

gr_tm

A GRanges object produced by tm_calculate() (or tm_calculate()$gr). Must contain at least a Tm metadata column. A gc column is used automatically when present.

gr_features

A GRanges object with multi-omic feature ranges. All (or a subset of) its metadata columns are transferred / aggregated.

strategy

Character. Integration strategy. One of "overlap" (default), "nearest", "window", or "bin".

feature_cols

Character vector. Names of metadata columns in gr_features to transfer. NULL (default) transfers all metadata columns.

prefix

Character. Prefix prepended to transferred column names to avoid clashes with existing columns in gr_tm. Default: "". Use e.g. "feat_" if there are naming conflicts.

window_size

Integer. Half-width (bp) of the symmetric window added around each Tm range in "window" mode. Default: 1000.

bin_size

Integer. Width (bp) of genomic bins in "bin" mode. Default: 1e6 (1 Mb). Smaller values give finer resolution but sparser coverage.

agg_fun

Function. Applied to numeric feature values when multiple features map to the same Tm range / bin. It is called as agg_fun(values, na.rm = TRUE), so it must accept an na.rm argument; mean, median, sum and max all qualify, whereas function(x) x[1] does not. Ignored for character columns, which are always joined as a comma-separated list of their unique values. Default: mean.

weight

Character. How features are combined within a range. "none" (default) gives every feature that passes the overlap test the same weight, whatever the length of its overlap. "overlap" computes a mean weighted by the number of overlapping base pairs, \sum_j w_{ij} v_j / \sum_j w_{ij} with w_{ij} the width of the intersection of range i and feature j.

The distinction matters wherever a signal changes sharply. A 200 bp window whose first 190 bp are covered at depth 5 and whose last 10 bp are covered at depth 200 has a true mean depth of 14.75; unweighted aggregation returns 102.5, because the 10 bp feature counts as much as the 190 bp one. Raising min_overlap does not fix this, it only reverses the sign of the bias by discarding the short feature entirely.

"overlap" requires agg_fun = mean: an overlap-weighted maximum has no accepted definition, and quietly ignoring agg_fun would return an unweighted value that looks weighted. It does not apply to strategy = "nearest", which performs no aggregation.

report_coverage

Logical. Add a covered_frac column giving the fraction of each range covered by at least one feature, computed after reducing the features so that overlapping ones are not counted twice. A weighted mean normalises by the covered bases, so a value derived from a quarter of a window is indistinguishable from one derived from all of it; this column is what makes the difference visible. Produced by the "overlap" and "window" strategies. Default: FALSE.

min_overlap

Integer. Minimum overlap in base pairs required between a Tm range and a feature range. It is a filter and not a weight: a feature either qualifies or does not, and a qualifying feature counts in full. Applies to the "overlap" strategy only; "window" and "bin" require a single overlapping base pair. Default: 1.

ignore_strand

Logical. If TRUE (default), strand is ignored when finding overlaps / nearest neighbours.

keep_unmatched

Logical. In "overlap" mode only: if TRUE (default) Tm ranges with no overlapping feature are retained with NA in the transferred columns. If FALSE, unmatched Tm ranges are dropped.

distance_col

Character. Name of the distance column added in "nearest" mode. Default: "distance_to_feature".

Value

Aggregating continuous signals

When several features map to the same range, numeric columns are summarised by agg_fun and character columns are joined as their unique values. Which features take part is decided by min_overlap, and how much each one counts is decided by weight. The two are easy to confuse, and the distinction is what determines whether a coverage-like signal is summarised correctly at a boundary.

Let R_i be the i-th range of gr_tm, F_j the j-th feature, x_j its value, and w_{ij} the number of base pairs R_i and F_j share. Write m for min_overlap and f for agg_fun. The features entering the summary of R_i are those with w_{ij} \ge m, and

v_i = f(\{x_j : w_{ij} \ge m\})

with weight = "none", or

v_i = \frac{\sum_j w_{ij} x_j}{\sum_j w_{ij}}

taken over the same features, with weight = "overlap".

The unweighted form gives a feature that overlaps by one base pair the same influence as one that spans the whole range. This is harmless where a signal is flat and wrong where it steps, which is to say at exon boundaries, peak edges and promoters. Raising min_overlap does not repair it: the threshold is a filter, so a short feature is either counted in full or discarded in full, and the bias changes sign rather than disappearing. The example below shows both failures against a case with a known answer.

The weighted mean normalises by the covered base pairs, not by the width of the range, so a value derived from a quarter of a window is indistinguishable from one derived from all of it. report_coverage = TRUE adds a covered_frac column giving the fraction of each range covered by at least one feature, computed after reduce-ing the features so that overlapping ones are not double counted. Multiply by it to convert a mean over covered bases into a mean over the range.

Weighting is not the default. Enabling it changes numeric output, and existing analyses should stay reproducible unless their author decides otherwise.

Author(s)

Junhui Li

Examples

## Aggregation: a coverage track with a known answer -----------------------
## Two 200 bp windows over a signal that steps sharply inside the first.
##
##   window 1  [  1 .. 200]        window 2  [401 .. 600]
##   depth     [  1 .. 190] = 5
##             [191 .. 400] = 200
##                                           [401 .. 450] = 60
library(GenomicRanges)

win <- GRanges("chr1", IRanges(start = c(1, 401), width = 200),
               Tm = c(70, 72))
cov <- GRanges("chr1", IRanges(start = c(1, 191, 401),
                               end   = c(190, 400, 450)),
               cov = c(5, 200, 60))

## Window 1 truly averages (5 * 190 + 200 * 10) / 200 = 14.75.
integrate_granges(win, cov, strategy = "overlap")$cov
## 102.5  60   the 10 bp feature counts as much as the 190 bp one

integrate_granges(win, cov, strategy = "overlap",
                  weight = "overlap")$cov
## 14.75  60   overlap-weighted mean recovers the true depth

integrate_granges(win, cov, strategy = "overlap", min_overlap = 20L)$cov
## 5      60   the threshold discards the short feature; bias reverses

## Window 2 is only a quarter covered. Weighting cannot show that, because
## it normalises by the covered bases; the coverage column can.
res <- integrate_granges(win, cov, strategy = "overlap",
                         weight = "overlap", report_coverage = TRUE)
res$cov                      # 14.75  60
res$covered_frac             # 1.00   0.25
res$cov * res$covered_frac   # 14.75  15    mean over the whole window

## Not run: 
library(GenomicRanges)

# -- Sample data ----------------------------------------------------------
set.seed(42)
gr_tm <- GRanges(
  seqnames = c(rep("chr1", 60), rep("chr2", 30)),
  ranges   = IRanges(
    start = c(sort(sample(1:249e6, 60)),
              sort(sample(1:243e6, 30))),
    width = sample(50:200, 90, replace = TRUE)
  ),
  Tm = runif(90, 55, 85),
  GC = runif(90, 30, 70)
)

gr_features <- GRanges(
  seqnames = c(rep("chr1", 40), rep("chr2", 20)),
  ranges   = IRanges(
    start = c(sort(sample(1:249e6, 40)),
              sort(sample(1:243e6, 20))),
    width = sample(500:5000, 60, replace = TRUE)
  ),
  score      = runif(60, 0, 100),
  peak_type  = sample(c("narrow", "broad"), 60, replace = TRUE),
  signal     = rnorm(60, 5, 2)
)

# Strategy 1: overlap - annotate Tm ranges with overlapping peak features
res_overlap <- integrate_granges(gr_tm, gr_features,
                                  strategy = "overlap")

# Strategy 2: nearest - every Tm range gets its closest peak + distance
res_nearest <- integrate_granges(gr_tm, gr_features,
                                  strategy = "nearest")
head(res_nearest$distance_to_feature)

# Strategy 3: window - 5 kb window around each probe
res_window <- integrate_granges(gr_tm, gr_features,
                                 strategy = "window", window_size = 5000)

# Strategy 4: bin - 500 kb genome bins with mean Tm and aggregated signal
res_bin <- integrate_granges(gr_tm, gr_features,
                              strategy = "bin", bin_size = 5e5)
as.data.frame(res_bin) |> head()

# Use a subset of feature columns and add a prefix
integrate_granges(gr_tm, gr_features,
                  strategy    = "overlap",
                  feature_cols = c("score", "peak_type"),
                  prefix       = "chip_")

## End(Not run)


Generate sliding-window genomic coordinate strings for Tm calculation

Description

Tiles one or more chromosomes from a BSgenome object into overlapping windows and returns a named character vector of coordinate strings in the format "chr:start-end:strand:genome_pkg:region_id". This vector is the primary input for downstream Tm calculation functions (tm_nn, tm_gc, tm_wallace) that accept genomic coordinate strings.

Usage

make_genomiccoord(
  bsgenome,
  chromosomes = NULL,
  window = 200L,
  slide = 50L,
  start = NULL,
  end = NULL,
  strand = "+",
  trim_N = c("ends", "filter", "none"),
  max_N_frac = 0.1,
  N_scan_block = window,
  region_prefix = "region",
  genome_pkg_name = NULL,
  as_vector = TRUE,
  verbose = TRUE
)

Arguments

bsgenome

A BSgenome object (e.g. BSgenome.Hsapiens.UCSC.hg38) or a character string with the BSgenome package name (loaded automatically).

chromosomes

Character vector of chromosome names to tile. Must be present in seqlevels(bsgenome). Default: the 24 standard human chromosomes paste0("chr", c(1:22, "X", "Y")).

window

Integer. Width of each sliding window in base pairs. Default 200L.

slide

Integer. Step size between consecutive window starts in base pairs. slide == window gives non-overlapping tiling; slide < window gives overlapping windows. Default 50L.

start

Integer or NULL. Override the start position for every chromosome. When NULL (default) the start is chromosome position 1 (adjusted for N-trimming if trim_N != "none"). Can be a named integer vector to set different starts per chromosome.

end

Integer or NULL. Override the end position for every chromosome. When NULL (default) the end is the chromosome length (adjusted for N-trimming). Can be a named integer vector.

strand

Character. Strand label embedded in the coordinate string. One of "+" (default) or "-".

trim_N

Character. N-base handling strategy. One of "ends" (default), "filter", or "none". See section N-base trimming above.

max_N_frac

Numeric in [0, 1]. Maximum fraction of N bases tolerated per window. Windows exceeding this threshold are dropped. Only used when trim_N = "filter". Default 0.1.

N_scan_block

Integer. Block size (bp) for the in-memory N-end detection scan used by trim_N = "ends". The chromosome range is loaded once and scanned block by block at C speed; values below 1 Mb are raised to 1 Mb. The detected positions are exact regardless of block size. Default: window.

region_prefix

Character. Prefix for region IDs embedded in the coordinate string. Default "region" (producing region1, region2, ...).

genome_pkg_name

Character or NULL. The genome package name to embed in the coordinate string (4th field). When NULL (default), the name is extracted automatically from the bsgenome object via S4Vectors::metadata(bsgenome). Supply explicitly when using a custom BSgenome object whose metadata name differs from the canonical package name.

as_vector

Logical. When TRUE (default), return a plain named character vector. When FALSE, return a data.frame with columns coord, chr, start, end, strand, genome, region_id, chr_start_used, chr_end_used – useful for downstream GRanges construction.

verbose

Logical. Print per-chromosome progress messages. Default TRUE.

Value

When as_vector = TRUE (default): a named character vector of coordinate strings, one element per window. Names are the region IDs (region1, region2, ...).

When as_vector = FALSE: a data.frame with columns coord, chr, win_start, win_end, strand, genome, region_id, chr_start_used, chr_end_used.

Coordinate string format

Each element of the returned vector follows the pattern:

  chr1:10001-10200:+:BSgenome.Hsapiens.UCSC.hg38:region1
  chr1:10051-10250:+:BSgenome.Hsapiens.UCSC.hg38:region2
  ...

Fields (colon-separated):

  1. chromosome – e.g. chr1

  2. start-end – 1-based, inclusive coordinates

  3. strand+ or -

  4. genome – BSgenome package name (character)

  5. region_id – unique label regionN

N-base trimming

Human (and most mammalian) chromosomes begin and end with long stretches of N bases that represent assembly gaps. Windows that consist entirely or predominantly of Ns produce meaningless Tm values. The function offers two trimming strategies controlled by trim_N:

"none"

No trimming. Windows start at start and end at end (or chromosome length).

"ends"

Detect the first and last positions of non-N bases on each chromosome using Biostrings::letterFrequency() on a coarse block scan, then trim start and end to those positions. Efficient: reads the chromosome sequence only once in blocks.

"filter"

Generate windows across the full start-end range but then remove any window whose N-base fraction exceeds max_N_frac (default 0.1, i.e. 10%). More granular than "ends" but slower because it reads each window sequence.

Author(s)

Junhui Li

See Also

tm_nn, tm_gc, tm_wallace, BSgenome, letterFrequency

Examples

## Not run: 
library(BSgenome.Hsapiens.UCSC.hg38)

## -- Basic usage: tile chr1 with 200 bp windows, 50 bp slide ----------
coords <- make_genomiccoord(
  bsgenome    = BSgenome.Hsapiens.UCSC.hg38,
  chromosomes = "chr1",
  window      = 200L,
  slide       = 50L
)
length(coords)      # number of windows on chr1
head(coords, 3)
# region1 "chr1:10001-10200:+:BSgenome.Hsapiens.UCSC.hg38:region1"
# region2 "chr1:10051-10250:+:BSgenome.Hsapiens.UCSC.hg38:region2"
# region3 "chr1:10101-10300:+:BSgenome.Hsapiens.UCSC.hg38:region3"

## -- Non-overlapping tiling (slide == window) -------------------------
coords_nonoverlap <- make_genomiccoord(
  bsgenome    = BSgenome.Hsapiens.UCSC.hg38,
  chromosomes = paste0("chr", 1:22),
  window      = 200L,
  slide       = 200L    # no overlap
)
length(coords_nonoverlap)   # ~15 million windows across autosomes

## -- Custom start/end (e.g. a specific sub-region) --------------------
coords_sub <- make_genomiccoord(
  bsgenome    = BSgenome.Hsapiens.UCSC.hg38,
  chromosomes = "chr1",
  window      = 200L,
  slide       = 50L,
  start       = 1000000L,
  end         = 2000000L
)
length(coords_sub)   # 19,981 windows in 1 Mb region

## -- No N-trimming (use full chromosome length) ------------------------
coords_noN <- make_genomiccoord(
  bsgenome    = BSgenome.Hsapiens.UCSC.hg38,
  chromosomes = "chr1",
  window      = 200L,
  slide       = 50L,
  trim_N      = "none"
)

## -- Per-window N-filtering (removes windows with >10% N) -------------
coords_filt <- make_genomiccoord(
  bsgenome    = BSgenome.Hsapiens.UCSC.hg38,
  chromosomes = "chr1",
  window      = 200L,
  slide       = 50L,
  trim_N      = "filter",
  max_N_frac  = 0.10
)

## -- Get data.frame output for GRanges construction -------------------
df <- make_genomiccoord(
  bsgenome    = BSgenome.Hsapiens.UCSC.hg38,
  chromosomes = "chr1",
  window      = 200L,
  slide       = 50L,
  as_vector   = FALSE
)
gr <- GenomicRanges::GRanges(
  seqnames = df$chr,
  ranges   = IRanges::IRanges(start = df$win_start, end = df$win_end),
  strand   = df$strand
)

## -- Pass directly to tm_nn -------------------------------------------
coords <- make_genomiccoord(
  bsgenome    = BSgenome.Hsapiens.UCSC.hg38,
  chromosomes = "chr1",
  window      = 200L,
  slide       = 200L,
  start       = 1000000L,
  end         = 1010000L
)
tm_results <- tm_nn(coords, Na = 50)

## End(Not run)


Plot genome tracks in linear or circular layout

Description

Visualise genomic tracks as either a linear karyoploteR plot or a circular plot (base R graphics). Set circular = TRUE to switch to the circular layout; the same track_list works for both views without modification.

Supported track types in each list element:

A track with ideogram = TRUE is drawn inside the chromosome bar (linear) or as the outermost ring with a grey background (circular). Only "rect" type is supported for ideogram tracks.

A per-track height field (numeric, default 1) controls relative sizing. In linear mode heights are proportional fractions of the data panel; in circular mode they scale the radial thickness of each ring.

A per-track highlight field (list or list-of-lists with data/col/alpha/border) draws highlight bands within that track only.

Entries with type = "highlight" draw translucent bands spanning all real tracks. These accept: data, col (default "#F1C40F"), alpha (default 0.18), border (default NA), and min.degree (circular only, default 0.4).

Each list element may also contain: name, col, bg.col, border, ylim, lwd, alpha (0–1 transparency), legend_font_col, ideogram, height, highlight.

Usage

plot_genome_track(
  genome_name,
  genome_size = NULL,
  genome = NULL,
  track_list,
  circular = FALSE,
  label = NULL,
  chromosomes = NULL,
  zoom = NULL,
  plot.type = 1,
  plot.params = NULL,
  main = NULL,
  track.gap = 0.01,
  legend.show = TRUE,
  legend.position = NULL,
  legend.cex = 0.6,
  legend.bty = "n",
  legend.border = NA,
  legend.font.col = "black",
  legend.lwd = 1,
  legend.seg.len = -0.5,
  legend.box.lwd = 0.25,
  legend.x.intersp = 1,
  legend.lty = 1,
  axis.cex = NULL,
  title.cex = NULL,
  base.tick.dist = NULL,
  base.tick.units = TRUE,
  start.degree = 34.47,
  track.height = 0.05,
  gap.after = 0,
  cell.padding = c(0, 0, 0, 0),
  track.margin = c(0.005, 0.005),
  circle.margin = c(0.001, 0.001),
  canvas.xlim = c(-1, 1),
  canvas.ylim = c(-1, 1),
  axis.unit = "Mb",
  axis.step = NULL,
  axis.show.unit = FALSE,
  label.column = 4,
  label.niceFacing = TRUE,
  label.cex = 0.6,
  label.side = "inside",
  label.labels_height = 0.01,
  label.connection_height = 0.03,
  label.line_lwd = 0.25
)

Arguments

genome_name

Character. Used for the title.

genome_size

Numeric. Total genome length (single-chromosome genomes).

genome

Optional GRanges, or a karyoploteR genome string (e.g. "hg38"). Ignored in circular mode.

track_list

List of track specs (see above).

circular

Logical. If TRUE, render as a circular plot using base R graphics instead of a karyoploteR linear plot.

label

Optional data.frame/GRanges with labels.

chromosomes

Character vector to restrict/reorder chromosomes (linear only).

zoom

A GRanges object, a character string, or a character vector specifying one or more regions to zoom into (e.g. "chr1:1e6-2e6" or c("chr1:1e6-1.2e6", "chr1:3e6-3.2e6")). In linear mode each region is drawn as a separate stacked panel. In circular mode the regions are concatenated around the circle with small gaps between them. NULL (default) shows the full genome.

plot.type

karyoploteR plot.type (linear only).

plot.params

Optional named list overriding entries of karyoploteR::getDefaultPlotParams() (linear only). The defaults size the margins for a single track, so several tracks in one panel leave conspicuous white space above and below; e.g. plot.params = list(topmargin = 15, bottommargin = 15, data1outmargin = 8). Unknown names are ignored with a warning.

main

Panel title. NULL (default) uses the genome name, with the interval appended when several zoom regions are drawn. Supply a character string to replace it, or NA / "" to omit it: a manuscript figure normally carries the genome and interval in its caption instead, and the title otherwise takes vertical space from the tracks. A vector of the same length as zoom titles each panel separately.

track.gap

Relative gap between tracks (linear only, 0 to ~0.05).

legend.show

Logical.

legend.position

Legend position. Character for linear (e.g. "topright"), numeric vector of length 2 for circular (e.g. c(0.75, 1)).

legend.cex, legend.bty, legend.border

See legend.

legend.font.col

Character. Default legend text colour.

legend.lwd, legend.seg.len, legend.box.lwd, legend.x.intersp, legend.lty

Additional legend parameters.

axis.cex

Axis label size.

title.cex

Title size.

base.tick.dist

Numeric or NULL (linear only).

base.tick.units

Logical (linear only). Append the unit to the base position labels, so that an axis reads 100 kb rather than 100, which on its own could be bases, kb or Mb. Default TRUE.

start.degree

Numeric. Starting angle in degrees for the circular layout (default 34.47, matching the circlize convention).

track.height, gap.after, cell.padding, track.margin

Kept for backward compatibility; ignored in the base R circular layout.

circle.margin

Numeric vector (length 2 or 4) controlling plot margins as fractions of the device size. Length 2 is recycled as c(bottom, left, bottom, left). Default c(0.001, 0.001).

canvas.xlim, canvas.ylim

Numeric length-2 vectors controlling the plotting window (circular only). Adjust to pan or zoom into a portion of the circle.

axis.unit, axis.step, axis.show.unit

Circular axis parameters.

label.column, label.niceFacing, label.cex, label.side, label.labels_height, label.connection_height, label.line_lwd

Circular label parameters.

Value

Invisibly returns the KaryoPlot object (linear) or NULL (circular).

Examples

## Not run: 
data(ecoli_rep_hotspots)

library("BSgenome.Ecoli.NCBI.ASM584v2")
genome_name <- "BSgenome.Ecoli.NCBI.ASM584v2"
chr_name    <- "U00096.3"
genome <- get(genome_name, envir = asNamespace(genome_name))
chr_length  <- length(genome[[chr_name]])
genome_name="BSgenome.Ecoli.NCBI.ASM584v2"
bins_gc <- make_genomiccoord(
  bsgenome    = genome_name,
  chromosomes = chr_name,
  window      = 200L,
  slide       = 200L,
  start       = 1,
  end         = chr_length,
  strand      = "+"
)
input_new <- list(pkg_name = genome_name, seq = bins_gc)
gr_batch <- to_genomic_ranges_fast(input_new)
tm_ASM584v2 <- tm_calculate(
  gr_batch,
  method   = "tm_nn"
)
Tm <- as.data.frame(tm_ASM584v2$gr[, c("Tm", "GC")])

tracks <- list(
  list(type = "rect", data = ecoli_rep_hotspots$all_peaks_IP_mutH,
       col = "#2C3E50", bg.col = "grey", name = "MutL-AR",
       legend_font_col = "#2C3E50", ideogram = TRUE, height = 0.5),
  list(type = "line", data = Tm, value_col = "GC",
       name = "GC content", col = "#4A90E2",
       legend_font_col = "#4A90E2"),
  list(type = "line", data = Tm, value_col = "Tm",
       name = "Melting temp", col = "#E06666",
       legend_font_col = "#E06666", height = 2),
  list(type = "line", data = ecoli_rep_hotspots$bins_rep,
       value_col = "count", name = "Microsatellites", col = "#2ECC71",
       legend_font_col = "#2ECC71"),
  list(type = "line", data = ecoli_rep_hotspots$bins_cru,
       value_col = "count", name = "Cruciform", col = "#3B3E6B",
       legend_font_col = "#3B3E6B"),
  list(data = ecoli_rep_hotspots$ssdna, name = "ssDNA",
       col = "#8E44AD", legend_font_col = "#8E44AD"),
  list(type = "line", data = ecoli_rep_hotspots$bins_gatc,
       value_col = "count", name = "GATC sites", col = "#D35400",
       legend_font_col = "#D35400"),
  list(type = "highlight", data = ecoli_rep_hotspots$all_peaks_IP_mutH,
       col = "#F1C40F", alpha = 0.18)
)

# Circular
plot_genome_track("E. coli", genome_size = 4641652,
                  track_list = tracks, circular = TRUE)

# Linear
plot_genome_track("E. coli", genome_size = 4641652,
                  track_list = tracks)

# Linear zoom (single region)
plot_genome_track("E. coli", genome_size = 4641652,
                  track_list = tracks,
                  zoom = "U00096.3:1000000-2000000")

# Linear zoom (multiple regions — stacked panels)
plot_genome_track("E. coli", genome_size = 4641652,
                  track_list = tracks,
                  zoom = c("U00096.3:1000000-1200000",
                           "U00096.3:3000000-3200000"))

# Circular zoom (multiple regions — concatenated arcs)
plot_genome_track("E. coli", genome_size = 4641652,
                  track_list = tracks, circular = TRUE,
                  zoom = c("U00096.3:1000000-1200000",
                           "U00096.3:3000000-3200000"))

# Circular with canvas panning
plot_genome_track("E. coli", genome_size = 4641652,
                  track_list = tracks, circular = TRUE,
                  canvas.xlim = c(0.5, 1), canvas.ylim = c(0, 1),
                  circle.margin = c(0.05, 0.05))

## End(Not run)


Compare Tm distributions across groups

Description

Visualise how melting temperature (and optionally other numeric metadata) differs between region classes such as peak vs. non-peak, mutant vs. wild-type, or any categorical annotation stored in a GRanges object. Designed as the visual companion to compare_groups().

Usage

plot_tm(
  gr,
  group,
  value = "Tm",
  plot_type = c("box", "violin", "rank", "density", "ridgeline", "ecdf", "sina"),
  color_palette = c("viridis", "magma", "plasma", "inferno", "cividis"),
  show_points = FALSE,
  point_size = 1,
  point_alpha = 0.3,
  notch = FALSE,
  add_mean = FALSE,
  facet_by = NULL,
  show_pvalue = FALSE,
  p_adjust_method = "BH",
  title = NULL,
  ylab = "Tm (°C)",
  xlab = NULL,
  show_legend = TRUE
)

Arguments

gr

A GRanges object containing at least a numeric Tm metadata column and a categorical grouping column.

group

Character. Name of the metadata column that defines the groups to compare (e.g. "in_mutH").

value

Character. Numeric metadata column to plot on the y-axis. Default: "Tm". Can be any numeric column such as "GC".

plot_type

Character. Visualisation style:

"box"

Box plot (default). Shows median, quartiles, and outliers per group.

"violin"

Violin plot with embedded box plot. Shows the full density shape of each group.

"rank"

Rank plot. All values sorted ascending on the x-axis, coloured by group. Visually demonstrates whether one group clusters at higher or lower values — a graphical Wilcoxon test.

"density"

Overlaid density curves per group.

"ridgeline"

Stacked density ridges per group (requires ggridges).

"ecdf"

Empirical cumulative distribution function per group. Useful for visualising distributional shifts.

"sina"

Sina (strip) plot — jittered points shaped by the local density, combining the resolution of a strip chart with the density information of a violin plot.

color_palette

Character. Viridis palette for group colours: "viridis" (default), "magma", "plasma", "inferno", or "cividis".

show_points

Logical. Overlay jittered points on box / violin plots. Default: FALSE. Ignored for rank, density, ridgeline, ecdf.

point_size

Numeric. Point size. Default: 1.

point_alpha

Numeric in [0, 1]. Point transparency. Default: 0.3.

notch

Logical. Draw notched box plots (approximate 95% CI for median). Default: FALSE.

add_mean

Logical. Add a diamond marker at the group mean on box / violin plots. Default: FALSE.

facet_by

Character or NULL. Optional metadata column to facet the plot by (e.g. "chromosome"). Default: NULL.

show_pvalue

Logical. Annotate the plot with Wilcoxon rank-sum test p-values. For two groups a single p-value is shown; for three or more groups all pairwise comparisons are displayed. P-values are placed as bracket annotations on box / violin / sina plots, or as a subtitle on density / ecdf / rank / ridgeline plots. Default: FALSE.

p_adjust_method

Character. Method for p-value adjustment when there are more than two groups (passed to p.adjust). Default: "BH" (Benjamini-Hochberg).

title

Character or NULL. Plot title. A sensible default is generated when NULL.

ylab

Character. Y-axis label. Default: "Tm (\u00B0C)".

xlab

Character. X-axis label. Default: group column name for box/violin/sina, "Rank" for rank, value for density/ecdf.

show_legend

Logical. Show colour legend. Default: TRUE.

Details

The function pairs naturally with integrate_granges() and compare_groups():

  1. Use integrate_granges() to annotate Tm windows with feature overlaps (e.g. ChIP-seq peaks, repeat classes).

  2. Use compare_groups() for the statistical test.

  3. Use plot_tm() to visualise the distributional difference.

Value

A ggplot object.

Examples

## Not run: 
library(GenomicRanges)
data(ecoli_rep_hotspots)

library("BSgenome.Ecoli.NCBI.ASM584v2")
genome_name <- "BSgenome.Ecoli.NCBI.ASM584v2"
chr_name    <- "U00096.3"
genome <- get(genome_name, envir = asNamespace(genome_name))
chr_length  <- length(genome[[chr_name]])
genome_name="BSgenome.Ecoli.NCBI.ASM584v2"
bins_gc <- make_genomiccoord(
  bsgenome    = genome_name,
  chromosomes = chr_name,
  window      = 200L,
  slide       = 200L,
  start       = 1,
  end         = chr_length,
  strand      = "+"
)
input_new <- list(pkg_name = genome_name, seq = bins_gc)
gr_batch <- to_genomic_ranges_fast(input_new)
tm_ASM584v2 <- tm_calculate(
  gr_batch,
  method   = "tm_nn"
)
gr_tm <- tm_ASM584v2$gr

# Annotate with MutL-AR peak membership
mutH_peaks <- GRanges(
  seqnames = ecoli_rep_hotspots$all_peaks_IP_mutH$chr,
  ranges   = IRanges(start = ecoli_rep_hotspots$all_peaks_IP_mutH$start,
                     end   = ecoli_rep_hotspots$all_peaks_IP_mutH$end)
)
mutH_peaks$peak_id <- paste0("mutH_", seq_along(mutH_peaks))
gr_annot <- integrate_granges(
  gr_tm = gr_tm, gr_features = mutH_peaks,
  strategy = "overlap", feature_cols = "peak_id",
  keep_unmatched = TRUE
)
gr_annot$in_mutH <- ifelse(is.na(gr_annot$peak_id), "non_peak", "peak")

# Box plot — peak vs non-peak Tm
plot_tm(gr_annot, group = "in_mutH")

# Box plot with Wilcoxon p-value bracket
plot_tm(gr_annot, group = "in_mutH", show_pvalue = TRUE)

# Violin plot with p-value and jittered points
plot_tm(gr_annot, group = "in_mutH", plot_type = "violin",
        show_points = TRUE, show_pvalue = TRUE)

# Rank plot — visual Wilcoxon test with p-value subtitle
plot_tm(gr_annot, group = "in_mutH", plot_type = "rank",
        show_pvalue = TRUE)

# Density overlay with p-value
plot_tm(gr_annot, group = "in_mutH", plot_type = "density",
        show_pvalue = TRUE)

# ECDF — cumulative distribution comparison
plot_tm(gr_annot, group = "in_mutH", plot_type = "ecdf",
        show_pvalue = TRUE)

# Compare GC content instead of Tm
plot_tm(gr_annot, group = "in_mutH", value = "GC", ylab = "GC content",
        show_pvalue = TRUE)

# Notched box plot with mean markers and p-value
plot_tm(gr_annot, group = "in_mutH", notch = TRUE, add_mean = TRUE,
        show_pvalue = TRUE)

## End(Not run)


Prints melting temperature from a TmCalculator object

Description

print.TmCalculator prints to console the melting temperature value from an object of class TmCalculator.

Usage

## S3 method for class 'TmCalculator'
print(x, ...)

Arguments

x

An object of class TmCalculator.

...

Unused

Value

The melting temperature value.


convert a string into a vector of characters

Description

Simply convert a single string such as "HelloWorld" into a vector of characters such as c("H","e","l","l","o","W","o","r","l","d")

Usage

s2c(strings)

Arguments

strings

A single string such as "HelloWorld"

Value

Retrun a vector of characters

Author(s)

Junhui Li

References

citation("TmCalculator")


Corrections of melting temperature with salt concentration

Description

Apply corrections to melting temperature calculations based on salt concentrations. Different correction methods are available for various experimental conditions.

Usage

salt_correct(
  Na = 0,
  K = 0,
  Tris = 0,
  Mg = 0,
  dNTPs = 0,
  method = c("Schildkraut2010", "Wetmur1991", "SantaLucia1996", "SantaLucia1998-1",
    "SantaLucia1998-2", "Owczarzy2004", "Owczarzy2008"),
  input_seq,
  ambiguous = FALSE
)

Arguments

Na

Millimolar concentration of sodium ions. Default: 0

K

Millimolar concentration of potassium ions. Default: 0

Tris

Millimolar concentration of Tris buffer. Default: 0

Mg

Millimolar concentration of magnesium ions. Default: 0

dNTPs

Millimolar concentration of deoxynucleotide triphosphates. Default: 0

method

Method for calculating salt concentration corrections to the melting temperature. Available options: - "Schildkraut2010": Updated salt correction method - "Wetmur1991": Classic salt correction method - "SantaLucia1996": DNA-specific salt correction - "SantaLucia1998-1": Improved DNA salt correction - "SantaLucia1998-2": Alternative DNA salt correction (requires input_seq) - "Owczarzy2004": Comprehensive salt correction (requires input_seq) - "Owczarzy2008": Updated comprehensive salt correction (requires input_seq) Note: Setting to NA disables salt correction

input_seq

Sequence (5' to 3') of one strand of the nucleic acid duplex. Can be provided as either: - A character string (e.g., "ATGCG") - A path to a FASTA file containing the sequence(s) Required for methods: "SantaLucia1998-2", "Owczarzy2004", and "Owczarzy2008"

ambiguous

Logical. If TRUE, ambiguous bases are taken into account when computing the G and C content. The function handles various ambiguous bases (S, W, M, K, R, Y, V, H, D, B) by proportionally distributing their contribution to GC content based on their possible nucleotide compositions.

Details

Different correction methods are available for various experimental conditions:

- Schildkraut2010: Updated salt correction method that accounts for monovalent and divalent cations - Wetmur1991: Classic salt correction method for monovalent cations - SantaLucia1996: DNA-specific salt correction - SantaLucia1998-1: Improved DNA salt correction - SantaLucia1998-2: Alternative DNA salt correction (requires sequence information) - Owczarzy2004: Comprehensive salt correction including effects of divalent cations (requires sequence information) - Owczarzy2008: Updated comprehensive salt correction (requires sequence information)

Author(s)

Junhui Li

References

Schildkraut C, Lifson S. Dependence of the melting temperature of DNA on salt concentration. Biopolymers. 1965;3(2):195-208.

Wetmur JG. DNA Probes: Applications of the Principles of Nucleic Acid Hybridization. Critical Reviews in Biochemistry and Molecular Biology. 1991;26(3-4):227-259.

SantaLucia J. A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics. Proceedings of the National Academy of Sciences. 1998;95(4):1460-1465.

Owczarzy R, Moreira BG, Manthey JA, et al. Predicting stability of DNA duplexes in solutions containing magnesium and monovalent cations. Biochemistry. 2008;47(19):5336-5353.

Examples


salt_correct(Na = 50, Mg = 1.5, method = "Owczarzy2008", 
               input_seq = "ATGCGATGCG")


Thermodynamic parameters for GC-based Tm calculation methods

Description

A data frame containing coefficients and parameters for different GC-based Tm calculation methods. Each row represents a different method with its specific coefficients (A, B, C, D) and salt correction method.

Usage

thermodynamic_gc_params

Format

A data frame with 8 rows and 5 columns:

A

Intercept coefficient

B

GC content coefficient

C

Length correction coefficient

D

Mismatch coefficient

salt_correct

Associated salt correction method

Details

The methods included are: - Chester1993: Tm = 69.3 + 0.41(Percentage_GC) - 650/N - QuikChange: Tm = 81.5 + 0.41(Percentage_GC) - 675/N - Percentage_mismatch - Schildkraut1965: Tm = 81.5 + 0.41(Percentage_GC) - 675/N + 16.6 x log10[Na+] - Wetmur1991_MELTING: Tm = 81.5 + 0.41(Percentage_GC) - 500/N + Wetmur salt - - Wetmur1991_RNA: Tm = 78 + 0.7(Percentage_GC) - 500/N + Wetmur salt - - Wetmur1991_RNA/DNA: Tm = 67 + 0.8(Percentage_GC) - 500/N + Wetmur salt - - Primer3Plus: Tm = 81.5 + 0.41(Percentage_GC) - 600/N + 16.6 x log10[Na+] - vonAhsen2001: Tm = 77.1 + 0.41(Percentage_GC) - 528/N + 11.7 x log10[Na+]


Thermodynamic Tables for Nucleic Acid Hybridization

Description

A comprehensive collection of thermodynamic parameters used for calculating melting temperatures of nucleic acid duplexes. The dataset includes parameters for DNA/DNA, RNA/RNA, RNA/DNA and 2'-O-methylRNA/RNA hybridizations, plus parameters for mismatches, dangling ends, internal / bulge loops, GU wobble, CNG repeats, inosine, hydroxyadenine, azobenzene and locked nucleic acids (LNA).

Usage

thermodynamic_nn_params

Format

A named list of two-column matrices with colnames = c("left", "right") (left = \Delta H, right = \Delta S). Rownames are dinucleotide step keys such as "AT/TA", mismatch / dangling-end keys, or feature-specific keys (e.g. "CAG_4" for the (CAG)4 CNG entry).

Populated tables

DNA_NN_Breslauer_1986

DNA/DNA NN, Breslauer et al. (1986)

DNA_NN_Sugimoto_1996

DNA/DNA NN, Sugimoto et al. (1996)

DNA_NN_Allawi_1998

DNA/DNA NN, Allawi (1998)

DNA_NN_SantaLucia_2004

DNA/DNA NN, SantaLucia & Hicks (2004)

RNA_NN_Freier_1986

RNA/RNA NN, Freier (1986)

RNA_NN_Xia_1998

RNA/RNA NN, Xia (1998)

RNA_NN_Chen_2012

RNA/RNA NN with GU, Chen / Serra (2012)

RNA_DNA_NN_Sugimoto_1995

RNA/DNA hybrid NN, Sugimoto (1995)

DNA_IMM_Peyret_1999

DNA single internal mismatch, Peyret (1999)

DNA_TMM_Bommarito_2000

DNA terminal mismatch, Bommarito (2000)

DNA_DE_Bommarito_2000

DNA single dangling end, Bommarito (2000)

RNA_DE_Turner_2010

RNA single dangling end, Turner (2010)

Registered placeholders (values TBD - populate from primary literature)

DNA_NN_AllSan_1997

Allawi & SantaLucia (1997) Biochemistry 36:10581

DNA_NN_SantaLucia_1996

SantaLucia et al. (1996) Biochemistry 35:3555

DNA_NN_Tanaka_2004

Tanaka et al. (2004) Biochemistry 43:7143

MeRNA_RNA_NN_Kierzek_2006

Kierzek et al. (2006) Biochemistry 45:581

DNA_RNA_IMM_Watkins_2011

Watkins et al. (2011) Nucleic Acids Res 39:1894

RNA_IMM_Lu_2006

Lu et al. (2006) Nucleic Acids Res 34:4912

RNA_IMM_Davis_Znosko_2007

Davis & Znosko (2007) Biochemistry 46:13425

RNA_IMM_Davis_Znosko_2008

Davis & Znosko (2008) Biochemistry 47:10178

DNA_TandemMM_AllSanPey

Allawi & SantaLucia (1997/1998); Peyret (1999)

RNA_TandemMM_Mathews_1999

Mathews et al. (1999) JMB 288:911

DNA_DE_Ohmichi_2002

Ohmichi et al. (2002) JACS 124:10367

RNA_DE_Ohmichi_2002

Ohmichi et al. (2002) JACS 124:10367

RNA_DE_Serra_2008

O'Toole / Serra (2006, 2008)

DNA_DDE_Ohmichi_2002

Ohmichi et al. (2002) JACS 124:10367

RNA_DDE_Ohmichi_2002

Ohmichi et al. (2002) JACS 124:10367

RNA_DDE_OToole_2005

O'Toole et al. (2005) Biochemistry 44:14914

RNA_DDE_OToole_2006

O'Toole et al. (2006) NAR 34:3338

DNA_LDE_Ohmichi_2002

Ohmichi et al. (2002) JACS 124:10367

RNA_LDE_Ohmichi_2002

Ohmichi et al. (2002) JACS 124:10367

DNA_IL_SantaLucia_2004

SantaLucia & Hicks (2004)

RNA_IL_Lu_2006

Lu et al. (2006) NAR 34:4912

RNA_IL_Badhwar_2007

Badhwar et al. (2007) Biochemistry 46:14715

DNA_SBL_Tanaka_2007

Tan & Chen (2007) Biophys J 92:3615

DNA_SBL_SantaLucia_2004

SantaLucia & Hicks (2004)

RNA_SBL_Lu_2006

Lu et al. (2006) NAR 34:4912

RNA_SBL_Blose_2007

Blose et al. (2007) Biochemistry 46:15123

DNA_LBL_SantaLucia_2004

SantaLucia & Hicks (2004)

RNA_LBL_Lu_2006

Mathews (1999); Lu et al. (2006)

RNA_GU_Mathews_1999

Mathews & Turner (1999) JMB 288:911

RNA_GU_Chen_2012

Chen / Serra (2012)

DNA_CNG_Broda_2005

Broda et al. (2005) Biochemistry 44:13851 - rownames use paste0("C", N, "G_", n), e.g. "CAG_4".

DNA_INO_SantaLucia_2005

Watkins & SantaLucia (2005) NAR 33:6258

RNA_INO_Wright_2007

Wright et al. (2007) Biochemistry 46:4625

DNA_HA_Kawakami_2001

Kawakami / Sugimoto (2001) Biochemistry 40:14040

DNA_AZB_Asanuma_2005

Asanuma et al. (2005) Angew Chem Int Ed 44:2747

DNA_LNA_Owczarzy_2011

Owczarzy et al. (2011) Biochemistry 50:9352

DNA_LNA_McTigue_2004

McTigue et al. (2004) Biochemistry 43:5388

DNA_cLNA_Owczarzy_2011

Owczarzy et al. (2011) Biochemistry 50:9352

DNA_cLNA_MM_Owczarzy_2011

Owczarzy et al. (2011) Biochemistry 50:9352

To add the numeric values for any placeholder table, construct a matrix with two columns (\Delta H kcal/mol, \Delta S cal/(mol*K)) and the dinucleotide-step rownames described above, then assign it:

thermodynamic_nn_params$DNA_CNG_Broda_2005 <- new_table

Details

Coverage mirrors the rmelting (Bioconductor) vignette sections 4.2.1 - 4.4. Tables whose numeric values are not yet ported from primary literature are included in the list as NULL placeholders so that tm_nn can still dispatch on the table name; the corresponding contribution is silently skipped after a one-time package-startup notice.

Source

Various publications as cited above.

References

Breslauer K J (1986) <doi:10.1073/pnas.83.11.3746> Sugimoto N (1996) <doi:10.1093/nar/24.22.4501> Allawi H (1998) <doi:10.1093/nar/26.11.2694> SantaLucia J (2004) <doi:10.1146/annurev.biophys.32.110601.141800> Freier S (1986) <doi:10.1073/pnas.83.24.9373> Xia T (1998) <doi:10.1021/bi9809425> Chen JL (2012) <doi:10.1021/bi3002709> Sugimoto N (1995) <doi:10.1016/S0048-9697(98)00088-6> Bommarito S (2000) <doi:10.1093/nar/28.9.1929> Peyret N (1999) <doi:10.1021/bi9825091> Allawi H T & SantaLucia J (1997) <doi:10.1021/bi962590c> SantaLucia J (2005) <doi:10.1093/nar/gki918> Turner D H (2010) <doi:10.1093/nar/gkp892> Tanaka F (2004) Biochemistry 43:7143 Kierzek E (2006) Biochemistry 45:581 Watkins N E (2011) Nucleic Acids Res 39:1894 Lu Z J (2006) Nucleic Acids Res 34:4912 Davis A R & Znosko B M (2007, 2008) Biochemistry Mathews D H (1999) <doi:10.1006/jmbi.1999.2700> Ohmichi T (2002) J Am Chem Soc 124:10367 O'Toole A S (2005, 2006) Biochemistry / Nucleic Acids Res Badhwar J (2007) Biochemistry 46:14715 Tan Z J & Chen S J (2007) Biophys J 92:3615 Blose J M (2007) Biochemistry 46:15123 Broda M (2005) <doi:10.1021/bi0501447> Wright D J (2007) Biochemistry 46:4625 Kawakami J / Sugimoto N (2001) <doi:10.1021/bi010918b> Asanuma H (2005) Angew Chem Int Ed 44:2747 McTigue P M (2004) Biochemistry 43:5388 Owczarzy R (2011) Biochemistry 50:9352

Examples

# Access DNA/DNA nearest neighbor parameters
thermodynamic_nn_params$DNA_NN_SantaLucia_2004

# Access DNA internal mismatch parameters
thermodynamic_nn_params$DNA_IMM_Peyret_1999

# See which tables are still placeholders (NULL)
names(Filter(is.null, thermodynamic_nn_params))

Calculate melting temperature using multiple methods

Description

Calculates nucleic acid melting temperature (Tm) by one of three methods, and returns the result as a GRanges object so that Tm can be used directly as a quantitative genomic feature alongside other assays:

Usage

tm_calculate(
  input_seq,
  method = c("tm_nn", "tm_gc", "tm_wallace"),
  complement_seq = NULL,
  ambiguous = FALSE,
  shift = 0,
  nn_table = c("DNA_NN_SantaLucia_2004", "DNA_NN_Ghosh_2020_PEG200",
    "DNA_NN_Breslauer_1986", "DNA_NN_Sugimoto_1996", "DNA_NN_Allawi_1998",
    "RNA_NN_Freier_1986", "RNA_NN_Xia_1998", "RNA_NN_Chen_2012", "RNA_NN_Zuber_2022",
    "RNA_NN_Ghosh_2023_PEG200", "RNA_DNA_NN_Sugimoto_1995", "DNA_NN_Weber_2015",
    "DNA_NN_Weber_OW04_69", "DNA_NN_Weber_OW04_119", "DNA_NN_Weber_OW04_220",
    "DNA_NN_Weber_OW04_621", "DNA_NN_Weber_OW04_1020", "RNA_NN_Weber_VIF_71",
    "RNA_NN_Weber_VIF_121", "RNA_NN_Weber_VIF_221", "RNA_NN_Weber_VIF_621", 
    
    "RNA_NN_Weber_VIF_1021", "RNA_NN_Weber_FIF_71", "RNA_NN_Weber_FIF_121",
    "RNA_NN_Weber_FIF_221", "RNA_NN_Weber_FIF_621", "RNA_NN_Weber_FIF_1021",
    "RNA_DNA_NN_Weber_2019_FT", "RNA_DNA_NN_Weber_2019_VH", "RNA_DNA_NN_Weber_2019_LS",
    "RNA_DNA_NN_Banerjee_2020"),
  tmm_table = "DNA_TMM_Bommarito_2000",
  imm_table = "DNA_IMM_Peyret_1999",
  de_table = c("DNA_DE_Bommarito_2000", "RNA_DE_Turner_2010"),
  dnac_high = 25,
  dnac_low = 25,
  self_comp = FALSE,
  variant = c("Primer3Plus", "Chester1993", "QuikChange", "Schildkraut1965",
    "Wetmur1991_MELTING", "Wetmur1991_RNA", "Wetmur1991_RNA/DNA", "vonAhsen2001"),
  userset = NULL,
  Na = 50,
  K = 0,
  Tris = 0,
  Mg = 0,
  dNTPs = 0,
  salt_method = c("Schildkraut2010", "Wetmur1991", "SantaLucia1996", "SantaLucia1998-1",
    "Owczarzy2004", "Owczarzy2008", "none"),
  DMSO = 0,
  formamide_unit = list(value = 0, unit = "percent"),
  dmso_factor = 0.75,
  formamide_factor = 0.65,
  mismatch = TRUE,
  regions = NULL,
  window = NULL,
  slide = window,
  unit = c("segment", "region"),
  segment_size = 5e+07,
  BPPARAM = NULL,
  keep_sequence = NULL,
  tmpdir = tempdir(),
  verbose = FALSE
)

Arguments

input_seq

Where the sequence comes from. One of:

  • Sequences, as a character vector in 5' to 3' direction, e.g. c("ATGCG", "GGCCA"). Names, when present, become the seqnames of the result; unnamed sequences are keyed by their position in the vector.

  • An installed BSgenome package, by name, e.g. "BSgenome.Hsapiens.UCSC.hg38". It is named rather than passed as a loaded object because each worker opens the genome for itself, so no sequence crosses between processes. See BSgenome::available.genomes() for what exists, and install the package before calling.

  • A FASTA file, by path; gzipped files are read directly.

  • A GRanges carrying a sequence metadata column. The complement is derived from it when absent.

regions selects from any of the four, and means the same thing in each: the identifier before the colon is resolved against whatever names the source itself offers, and falls back to position. A BSgenome or a FASTA file with no regions is taken whole, which for a genome means its standard chromosomes.

Also accepted, and unchanged from earlier versions: a character vector of coordinate strings "chr:start-end:strand:species", for example "chr1:100-200:+:BSgenome.Hsapiens.UCSC.hg38", where strand defaults to "+". This form carries its own genome in every element, so it is read directly and ignores regions; to profile coordinates against a genome, prefer passing the genome here and the coordinates as regions.

method

Method(s) to use for Tm calculation. Can be one or more of: - "tm_nn": Nearest Neighbor thermodynamics (default) - "tm_gc": GC content-based method - "tm_wallace": Wallace rule Default: c("tm_nn", "tm_gc", "tm_wallace")

complement_seq

Complementary sequence(s) in 3' to 5' direction. If not provided, the function will automatically generate it from input_seq. This is the template/target sequence that the input sequence will hybridize with. Can be provided as input_seq format besides A NULL value(default)

ambiguous

Logical. If TRUE, ambiguous bases are taken into account when computing the G and C content. The function handles various ambiguous bases (S, W, M, K, R, Y, V, H, D, B) by proportionally distributing their contribution to GC content based on their possible nucleotide compositions. Default: FALSE

shift

Integer value controlling the alignment offset between primer and template sequences. Only applicable for the NN method. Default: 0

nn_table

Thermodynamic nearest-neighbor parameters for different nucleic acid hybridizations. Only applicable for the NN method. Sets whose name encodes a sodium concentration were fitted at that condition and are not salt-corrected again. See tm_nn for the full list and guidance on choosing between them. Default: "DNA_NN_SantaLucia_2004"

Alternatively, supply a matrix or data.frame of parameters directly. This is the route for parameter sets the package does not ship, in particular sets covering modified bases such as 5-methylcytosine. Requirements:

  • numeric, with columns 1 and 2 read as delta H (kcal/mol) and delta S (cal/mol/K); further columns are ignored;

  • row names giving the parameter keys, e.g. "AA/TT", "init", "init_A/T", "sym";

  • every key of a built-in reference set must be present. The reference is named by attr(x, "reference"), or defaults to the first built-in listed for the argument, which is a DNA/DNA set; RNA and hybrid tables should therefore set the attribute. Extra keys beyond the reference are kept, which is how a modified-base set adds stacks rather than replacing them.

The supplied table is reordered to the reference key order before use, so that two tables differing only in row order give identical results. A missing key would otherwise contribute zero to the calculation instead of raising an error, which is why the full key set is required. Keys that disagree with their reverse complement produce a warning: expected for modified bases, a transposition error otherwise.

Two optional attributes are honoured. attr(x, "salt_mM") marks a set as fitted at a stated sodium concentration, which suppresses the salt correction at that concentration exactly as for the built-in sets fitted this way; without it the table is treated as a reference-condition set and salt_method is applied. attr(x, "end_table") supplies a companion penultimate-pair end-effect table.

tmm_table

Thermodynamic parameters for terminal mismatches. Only applicable for the NN method. Default: "DNA_TMM_Bommarito_2000"

imm_table

Thermodynamic parameters for internal mismatches. Only applicable for the NN method. Default: "DNA_IMM_Peyret_1999"

de_table

Thermodynamic parameters for dangling ends. Only applicable for the NN method. Default: "DNA_DE_Bommarito_2000"

dnac_high

Concentration of the higher concentrated strand in nM. Only applicable for the NN method. Default: 25

dnac_low

Concentration of the lower concentrated strand in nM. Only applicable for the NN method. Default: 25

self_comp

Logical value indicating if the sequence is self-complementary. Only applicable for the NN method. Default: FALSE

variant

Empirical constants coefficient for GC method. Only applicable for the GC method. Default: "Primer3Plus"

userset

A vector of four coefficient values for GC method. Only applicable for the GC method. Usersets override value sets. Default: NULL

Na

Millimolar concentration of sodium ions. Default: 50

K

Millimolar concentration of potassium ions. Default: 0

Tris

Millimolar concentration of Tris buffer. Default: 0

Mg

Millimolar concentration of magnesium ions. Default: 0

dNTPs

Millimolar concentration of deoxynucleotide triphosphates. Default: 0

salt_method

Salt correction method for Tm. Default: "Schildkraut2010" Available options: - "none": Disables salt correction. Also selected automatically when the chosen nn_table was fitted at the requested Na. - "Schildkraut2010": Updated salt correction method - "Wetmur1991": Classic salt correction method - "SantaLucia1996": DNA-specific salt correction - "SantaLucia1998-1": Improved DNA salt correction - "Owczarzy2004": Comprehensive salt correction - "Owczarzy2008": Updated comprehensive salt correction Default: "Schildkraut2010"

DMSO

Percent DMSO concentration in the reaction mixture. Default: 0

formamide_unit

Formamide concentration as 'list(value, unit)'. Default: list(value = 0, unit = "percent") - value: Numeric value of formamide concentration - unit: Either "percent" or "molar"

dmso_factor

Coefficient of Tm decreases per percent DMSO. Default: 0.75 Other published values are 0.5, 0.6 and 0.675.

formamide_factor

Tm decrease per percent formamide. Default: 0.65 Several papers report factors between 0.6 and 0.72.

mismatch

Logical. If TRUE, every '.' in the sequence is counted as a mismatch. Only applicable for the GC method. Default: TRUE

regions

What to take from input_seq. NULL, the default, means all of it, except for a BSgenome, where it means GenomeInfoDb::standardChromosomes() of that genome, which for GRCh38 includes chrM. Otherwise: names or numbers (c("chr1", "chr2"), 1:2), coordinate strings "name:start-end" with commas and scientific notation accepted ("chr1:5,000,000-6e6"), a mixture of the two, or a GRanges.

The identifier before the colon is resolved against whatever names the source itself offers, and falls back to position. So "chr1" is a chromosome in a BSgenome, a record in a FASTA file and a seqname in a GRanges, and "1:1-200" is the first 200 bases of the first sequence in an unnamed character vector. On a BSgenome the chr prefix is added or removed as the genome requires, since that is a convention rather than information; elsewhere names are matched exactly.

window

Window width in base pairs. NULL, the default, gives one melting temperature per region, which is what short records such as probes, primers and oligonucleotides call for; a region longer than 1 Mb with window = NULL is an error rather than one meaningless Tm. Regions shorter than window are returned whole.

slide

Step between window starts, defaulting to window for a non-overlapping tiling. Ignored when window is NULL.

unit

How regions become tasks: "segment" cuts them into pieces of about segment_size bp, "region" makes one task per region. Segments are faster and need less memory per worker, because no worker then holds a whole large chromosome.

segment_size

Task size in base pairs when unit = "segment", rounded down to a multiple of slide so that the window grid is the one an unsegmented run would produce. Default 50 Mb.

BPPARAM

A BiocParallelParam from BiocParallel, e.g. SnowParam(workers = 5), to spread the tasks over processes. NULL, the default, runs them here, with no dependency on BiocParallel. Parallelism divides the work by region, never the sequences of one region: each task opens the source itself, so only a name and a coordinate pair cross between processes.

keep_sequence

Keep the sequence and complement columns. The default keeps them for sequences the caller supplied and drops them for a genome or a file, where they run to roughly 500 MB per large chromosome.

tmpdir

Directory for the temporary FASTA file written when sequences are supplied directly and there is tiling or parallelism to do. Worth setting on a cluster, where tempdir() is often a small partition.

verbose

Report the task and window counts.

Details

The input sequence is processed once and passed to the selected method, which is faster than calling the individual functions separately.

The three methods differ in resolution and in the range of sequence lengths over which they are calibrated, so they are not interchangeable.

tm_nn is the appropriate default. Because it sums sequence-dependent stacking terms, it distinguishes sequences of identical GC content but different base order, which the other two cannot. Its parameters were derived from short duplexes under a two-state assumption; when applied to long sequences or to fixed-width genomic windows the resulting value is best read as a relative measure of local thermodynamic stability for comparison across windows, rather than as an absolute experimental melting temperature.

tm_gc computes Tm from GC percentage using one of several published empirical formulas selected by variant, with corrections for length and ionic strength. It extends to longer sequences at low computational cost but cannot resolve base order.

tm_wallace applies the 2 + 4 rule, adding 2 ^{\circ}C per A or T and 4 ^{\circ}C per G or C. It is calibrated for short oligonucleotides, typically 14 to 20 bp, and takes no account of sequence context, salt or chemical additives. Accuracy degrades quickly with length, so it is retained for compatibility rather than recommended for genome-scale work.

Salt and chemical corrections apply to tm_nn and tm_gc only. The input sequence is parsed and validated once and reused by the selected method, which is faster than calling the individual functions directly.

Value

A TmCalculator list with:

gr

The input GRanges with metadata columns Tm and GC (melting temperature in ^{\circ}C and GC percent).

options

Calculation parameters and method information. For the nearest-neighbor method this includes Salt correction applied (logical) and Parameter set fitted at [Na+] (mM), which record whether a salt correction was actually performed.

Salt handling

Most nearest-neighbor parameter sets were fitted at a single reference sodium concentration, and other conditions are reached through the salt_method correction formulas. The Weber/VarGibbs sets were instead fitted directly at a stated sodium concentration and are meant to replace salt correction. When such a set is selected and Na matches the concentration it was fitted at, correction is skipped automatically; when it does not, correction is applied with a warning. See tm_nn for details.

Available Options

Method Selection:

Nearest Neighbor (NN) Method Options:

GC Method Options:

Salt Correction Options:

Formamide Unit Options:

Other Parameters:

Author(s)

Junhui Li

See Also

tm_nn for the nearest-neighbor method and the full list of thermodynamic parameter sets.

Examples

## Not run: 
input_seq <- c("chr1:1000100-1000150:+:BSgenome.Hsapiens.UCSC.hg38")
result <- tm_calculate(
  input_seq,
  method = "tm_nn",
  nn_table = "DNA_NN_SantaLucia_2004",
  salt_method = "Owczarzy2008"
)

# A hybrid parameter set fitted at 100 mM sodium. Salt correction is
# skipped automatically because Na matches the fitted condition.
result_ls <- tm_calculate(
  input_seq,
  method = "tm_nn",
  nn_table = "RNA_DNA_NN_Weber_2019_LS",
  Na = 100
)

# Genome scale. The source is named rather than loaded, because each
# worker opens it for itself; `regions` says what to cover and `window`
# says at what resolution.
hg38 <- "BSgenome.Hsapiens.UCSC.hg38"
tm_calculate(hg38, regions = "chr21:10e6-20e6", window = 200, slide = 200)

# Five processes. Tasks are divided by region, never by splitting the
# sequences of one region, so only coordinates cross between them.
library(BiocParallel)
whole <- tm_calculate(hg38, window = 200, slide = 200,
                      BPPARAM = SnowParam(workers = 5))
whole$gr

# The same, for a FASTA file and for sequences already in R. With
# window = NULL, the default, each record returns a single Tm, which is
# what a file of probes or primers calls for.
tm_calculate("probes.fa", BPPARAM = SnowParam(workers = 4))
tm_calculate(c("ACGTGCTAGCTAGCTAGC", "GGCCATATATGCGC"))

## End(Not run)


Calculate the melting temperature using empirical formulas based on GC content

Description

Calculate the melting temperature using empirical formulas based on GC content with different options. The function returns a list of sequences with updated Tm attributes and calculation options.

Usage

tm_gc(
  gr_seq,
  ambiguous = FALSE,
  userset = NULL,
  variant = c("Primer3Plus", "Chester1993", "QuikChange", "Schildkraut1965",
    "Wetmur1991_MELTING", "Wetmur1991_RNA", "Wetmur1991_RNA/DNA", "vonAhsen2001"),
  Na = 50,
  K = 0,
  Tris = 0,
  Mg = 0,
  dNTPs = 0,
  salt_method = c("Schildkraut2010", "Wetmur1991", "SantaLucia1996", "SantaLucia1998-1",
    "Owczarzy2004", "Owczarzy2008"),
  mismatch = TRUE,
  DMSO = 0,
  formamide_unit = list(value = 0, unit = "percent"),
  dmso_factor = 0.75,
  formamide_factor = 0.65
)

Arguments

gr_seq

Pre-processed sequence(s) in 5' to 3' direction. This should be the output from to_genomic_ranges() function.

ambiguous

Logical. If TRUE, ambiguous bases are taken into account when computing the G and C content. The function handles various ambiguous bases (S, W, M, K, R, Y, V, H, D, B) by proportionally distributing their contribution to GC content based on their possible nucleotide compositions.

userset

A vector of four coefficient values. Usersets override value sets.

variant

Empirical constants coefficient with 8 variants: - Chester1993: Tm = 69.3 + 0.41(Percentage_GC) - 650/N - QuikChange: Tm = 81.5 + 0.41(Percentage_GC) - 675/N - Percentage_mismatch - Schildkraut1965: Tm = 81.5 + 0.41( - Wetmur1991_MELTING: Tm = 81.5 + 0.41( - Wetmur1991_RNA: Tm = 78 + 0.7( - Wetmur1991_RNA/DNA: Tm = 67 + 0.8( - Primer3Plus: Tm = 81.5 + 0.41( - vonAhsen2001: Tm = 77.1 + 0.41(

Salt correction is applied only for variants that include it in the formula (via salt_correct()). Chester1993 and QuikChange use no salt term. D is the mismatch penalty (typically 1): Tm decreases by D x ( Use X (or .) in the sequence to mark mismatch positions.

Na

Millimolar concentration of sodium ions. Default: 50

K

Millimolar concentration of potassium ions. Default: 0

Tris

Millimolar concentration of Tris buffer. Default: 0

Mg

Millimolar concentration of magnesium ions. Default: 0

dNTPs

Millimolar concentration of deoxynucleotide triphosphates. Default: 0

salt_method

Salt correction method. NULL (default) uses the method associated with variant. Set to NA to disable salt correction. Options: - "Schildkraut2010": Schildkraut & Lifson 1965 - "Wetmur1991": Wetmur 1991 - "SantaLucia1996": SantaLucia 1996 - "SantaLucia1998-1": SantaLucia 1998 (Method 1) - "Owczarzy2004": Owczarzy 2004 - "Owczarzy2008": Owczarzy 2008 Note: "SantaLucia1998-2" is not available for this function.

mismatch

Logical. If TRUE (default), every 'X' in the sequence is counted as a mismatch

DMSO

Percent DMSO concentration in the reaction mixture. Default: 0

formamide_unit

Formamide concentration as 'list(value, unit)'. Default: list(value = 0, unit = "percent") - value: Numeric value of formamide concentration - unit: Either "percent" or "molar"

dmso_factor

Coefficient of Tm decreases per percent DMSO. Default: 0.75 (von Ahsen et al. 2001) Other published values are 0.5, 0.6 and 0.675.

formamide_factor

Coefficient of Tm decrease per percent formamide. Default: 0.65 Several papers report factors between 0.6 and 0.72.

Value

Returns a list with two components: - Tm: A list of sequences with updated Tm attributes - Options: A list containing calculation parameters and method information

Author(s)

Junhui Li

References

Marmur J, Doty P. Determination of the base composition of deoxyribonucleic acid from its thermal denaturation temperature. Journal of Molecular Biology, 1962, 5(1):109-118.

Schildkraut C. Dependence of the melting temperature of DNA on salt concentration. Biopolymers, 2010, 3(2):195-208.

Wetmur JG. DNA Probes: Applications of the Principles of Nucleic Acid Hybridization. CRC Critical Reviews in Biochemistry, 1991, 26(3-4):33.

Untergasser A, Cutcutache I, Koressaar T, et al. Primer3–new capabilities and interfaces. Nucleic Acids Research, 2012, 40(15):e115-e115.

von Ahsen N, Wittwer CT, Schutz E, et al. Oligonucleotide melting temperatures under PCR conditions: deoxynucleotide Triphosphate and Dimethyl sulfoxide concentrations with comparison to alternative empirical formulas. Clin Chem 2001, 47:1956-1961.

Examples


# Example with multiple sequences
input_seq <- c("ATCGTGCGTAGCAGTACGATCAGTAG", "ATCGTGCGTAGCAGTACGATCAGTAG")
gr_seq <- to_genomic_ranges(input_seq)
out <- tm_gc(gr_seq, ambiguous = TRUE, variant = "Primer3Plus", Na = 50, mismatch = TRUE)
out
out$Options


Calculate melting temperature using nearest neighbor thermodynamics

Description

Calculates melting temperature (Tm) from nearest-neighbor (NN) thermodynamics, summing the stacking enthalpies and entropies of adjacent base-pair steps and applying initiation, symmetry, salt and chemical corrections. Terminal mismatches, internal mismatches and dangling ends are supported through dedicated parameter tables. The function verifies that every dinucleotide step in the input sequence is present in the selected tables before calculating.

Usage

tm_nn(
  gr_seq,
  ambiguous = FALSE,
  shift = 0,
  nn_table = c("DNA_NN_SantaLucia_2004", "DNA_NN_Ghosh_2020_PEG200",
    "DNA_NN_Breslauer_1986", "DNA_NN_Sugimoto_1996", "DNA_NN_Allawi_1998",
    "RNA_NN_Freier_1986", "RNA_NN_Xia_1998", "RNA_NN_Chen_2012", "RNA_NN_Zuber_2022",
    "RNA_NN_Ghosh_2023_PEG200", "RNA_DNA_NN_Sugimoto_1995", "DNA_NN_Weber_2015",
    "DNA_NN_Weber_OW04_69", "DNA_NN_Weber_OW04_119", "DNA_NN_Weber_OW04_220",
    "DNA_NN_Weber_OW04_621", "DNA_NN_Weber_OW04_1020", "RNA_NN_Weber_VIF_71",
    "RNA_NN_Weber_VIF_121", "RNA_NN_Weber_VIF_221", "RNA_NN_Weber_VIF_621", 
    
    "RNA_NN_Weber_VIF_1021", "RNA_NN_Weber_FIF_71", "RNA_NN_Weber_FIF_121",
    "RNA_NN_Weber_FIF_221", "RNA_NN_Weber_FIF_621", "RNA_NN_Weber_FIF_1021",
    "RNA_DNA_NN_Weber_2019_FT", "RNA_DNA_NN_Weber_2019_VH", "RNA_DNA_NN_Weber_2019_LS",
    "RNA_DNA_NN_Banerjee_2020"),
  tmm_table = "DNA_TMM_Bommarito_2000",
  imm_table = "DNA_IMM_Peyret_1999",
  de_table = c("DNA_DE_Bommarito_2000", "RNA_DE_Turner_2010"),
  dnac_high = 25,
  dnac_low = 25,
  self_comp = FALSE,
  Na = 50,
  K = 0,
  Tris = 0,
  Mg = 0,
  dNTPs = 0,
  salt_method = c("Schildkraut2010", "Wetmur1991", "SantaLucia1996", "SantaLucia1998-1",
    "Owczarzy2004", "Owczarzy2008", "none"),
  DMSO = 0,
  formamide_unit = list(value = 0, unit = "percent"),
  dmso_factor = 0.75,
  formamide_factor = 0.65
)

Arguments

gr_seq

Pre-processed sequence(s) in 5' to 3' direction. This should be the output from to_genomic_ranges() function.

ambiguous

Logical value controlling how ambiguous bases are handled: - TRUE: Ambiguous bases (e.g., N, R, Y) are included in calculations - FALSE (default): Ambiguous bases are excluded from calculations

shift

Integer value controlling the alignment offset between primer and template sequences. Visual representation of different shift values:

shift = 0 (default): Primer: 5' ATGCG 3' Template: 3' TACGC 5'

shift = -1: Primer: 5' ATGCG 3' Template: 3' TACGC 5' ^

shift = 1: Primer: 5' ATGCG 3' Template: 3' TACGC 5' ^

The shift parameter is necessary when: - Sequences have different lengths - Dangling ends are required - Specific alignment positions are needed

nn_table

Thermodynamic nearest-neighbor parameters for different nucleic acid hybridizations. Parameter sets are listed below by hybridization type. Sets marked with a sodium concentration were fitted at that condition and are not salt-corrected further (see the "Choosing a parameter set" section).

DNA/DNA hybridizations, reference salt: - "DNA_NN_Breslauer_1986": Original DNA/DNA parameters - "DNA_NN_Sugimoto_1996": Improved DNA/DNA parameters - "DNA_NN_Allawi_1998": DNA/DNA parameters with internal mismatch corrections - "DNA_NN_SantaLucia_2004": Unified DNA/DNA parameters (default)

DNA/DNA hybridizations, melting-temperature optimized (Weber 2015): - "DNA_NN_Weber_2015": Combined dataset, 1020 mM. Recommended when a salt-optimized DNA set is wanted at high salt - "DNA_NN_Weber_OW04_69", "...119", "...220", "...621", "...1020": fitted independently at 69, 119, 220, 621 and 1020 mM sodium

DNA/DNA under molecular crowding (cell-like rather than dilute solution): - "DNA_NN_Ghosh_2020_PEG200": fitted in 40 wt

RNA/RNA hybridizations, reference salt: - "RNA_NN_Freier_1986": Original RNA/RNA parameters - "RNA_NN_Xia_1998": Improved RNA/RNA parameters - "RNA_NN_Chen_2012": Updated RNA/RNA parameters with GU pair corrections - "RNA_NN_Zuber_2022": Successor to Xia 1998 with improved end effects. The terminal-AU penalty is replaced by end terms that depend on the penultimate base pair, applied automatically from a companion table

RNA/RNA under molecular crowding (cell-like rather than dilute solution): - "RNA_NN_Ghosh_2023_PEG200": fitted in 40 wt and shown to describe duplexes in an intracellular cation composition

RNA/RNA hybridizations, salt-optimized (Ferreira 2019). VIF (variable initiation factors) gave better cross-validation than FIF (fixed): - "RNA_NN_Weber_VIF_71", "...121", "...221", "...621", "...1021" - "RNA_NN_Weber_FIF_71", "...121", "...221", "...621", "...1021"

RNA/DNA hybridizations: - "RNA_DNA_NN_Sugimoto_1995": RNA/DNA hybridization parameters - "RNA_DNA_NN_Weber_2019_FT": curve-fitting derived, 1000 mM. Best performing high-salt hybrid set in Basilio Barbosa (2019) - "RNA_DNA_NN_Weber_2019_VH": van't Hoff derived, 1000 mM - "RNA_DNA_NN_Weber_2019_LS": low salt, 100 mM - "RNA_DNA_NN_Banerjee_2020": improved hybrid parameters fitted at a physiological condition (100 mM NaCl), Banerjee et al. (2020)

Alternatively, supply a matrix or data.frame of parameters directly. This is the route for parameter sets the package does not ship, in particular sets covering modified bases such as 5-methylcytosine. Requirements:

  • numeric, with columns 1 and 2 read as delta H (kcal/mol) and delta S (cal/mol/K); further columns are ignored;

  • row names giving the parameter keys, e.g. "AA/TT", "init", "init_A/T", "sym";

  • every key of a built-in reference set must be present. The reference is named by attr(x, "reference"), or defaults to the first built-in listed for the argument, which is a DNA/DNA set; RNA and hybrid tables should therefore set the attribute. Extra keys beyond the reference are kept, which is how a modified-base set adds stacks rather than replacing them.

The supplied table is reordered to the reference key order before use, so that two tables differing only in row order give identical results. A missing key would otherwise contribute zero to the calculation instead of raising an error, which is why the full key set is required. Keys that disagree with their reverse complement produce a warning: expected for modified bases, a transposition error otherwise.

Two optional attributes are honoured. attr(x, "salt_mM") marks a set as fitted at a stated sodium concentration, which suppresses the salt correction at that concentration exactly as for the built-in sets fitted this way; without it the table is treated as a reference-condition set and salt_method is applied. attr(x, "end_table") supplies a companion penultimate-pair end-effect table.

tmm_table

Thermodynamic parameters for terminal mismatches. Default: "DNA_TMM_Bommarito_2000" These parameters account for mismatches at the ends of the duplex.

imm_table

Thermodynamic parameters for internal mismatches. Default: "DNA_IMM_Peyret_1999" These parameters account for mismatches within the duplex, including inosine mismatches.

de_table

Thermodynamic parameters for dangling ends. Default: "DNA_DE_Bommarito_2000" Available options: - "DNA_DE_Bommarito_2000": Parameters for DNA dangling ends - "RNA_DE_Turner_2010": Parameters for RNA dangling ends

dnac_high

Concentration of the higher concentrated strand in nM. Default: 25 Typically this is the primer (for PCR) or the probe concentration.

dnac_low

Concentration of the lower concentrated strand in nM. Default: 25 This is typically the template concentration.

self_comp

Logical value indicating if the sequence is self-complementary: - TRUE: Sequence can bind to itself, dnac_low is ignored - FALSE (default): Sequence binds to a different complementary sequence

Na

Millimolar concentration of sodium ions. Default: 50

K

Millimolar concentration of potassium ions. Default: 0

Tris

Millimolar concentration of Tris buffer. Default: 0

Mg

Millimolar concentration of magnesium ions. Default: 0

dNTPs

Millimolar concentration of deoxynucleotide triphosphates. Default: 0

salt_method

Salt correction method. Options are: Available options: - "Schildkraut2010": Updated salt correction method - "Wetmur1991": Classic salt correction method - "SantaLucia1996": DNA-specific salt correction - "SantaLucia1998-1": Improved DNA salt correction - "Owczarzy2004": Comprehensive salt correction - "Owczarzy2008": Updated comprehensive salt correction - "none": Disables salt correction entirely Note: Parameter sets fitted at a specific sodium concentration (those carrying a "salt_mM" attribute, e.g. the Weber/VarGibbs series and Banerjee 2020) already account for salt. When the requested Na matches the concentration such a set was fitted at, salt correction is skipped automatically; when it does not, a warning is issued.

DMSO

Percent DMSO concentration in the reaction mixture. Default: 0 DMSO can lower the melting temperature of nucleic acid duplexes.

formamide_unit

Formamide concentration as 'list(value, unit)'. Default: list(value = 0, unit = "percent") - value: numeric value of formamide concentration - unit: character string specifying the unit ("percent" or "molar") Default: list(value=0, unit="percent")

dmso_factor

Coefficient of melting temperature (Tm) decrease per percent DMSO. Default: 0.75 (von Ahsen N, 2001, PMID:11673362) Other published values: 0.5, 0.6, 0.675

formamide_factor

Coefficient of melting temperature (Tm) decrease per percent formamide. Default: 0.65 Literature reports values ranging from 0.6 to 0.72

Details

DNA_NN_Breslauer_1986: Breslauer K J (1986) <doi:10.1073/pnas.83.11.3746>

DNA_NN_Sugimoto_1996: Sugimoto N (1996) <doi:10.1093/nar/24.22.4501>

DNA_NN_Allawi_1998: Allawi H (1998) <doi:10.1093/nar/26.11.2694>

DNA_NN_SantaLucia_2004: SantaLucia J (2004) <doi:10.1146/annurev.biophys.32.110601.141800>

RNA_NN_Freier_1986: Freier S (1986) <doi:10.1073/pnas.83.24.9373>

RNA_NN_Xia_1998: Xia T (1998) <doi:10.1021/bi9809425>

RNA_NN_Chen_2012: Chen JL (2012) <doi:10.1021/bi3002709>

RNA_DNA_NN_Sugimoto_1995: Sugimoto N (1995)<doi:10.1016/S0048-9697(98)00088-6>

The following sets were derived by melting-temperature optimization and are fitted at the sodium concentration given in parentheses. They are not salt-corrected further; see the “Choosing a parameter set” section.

DNA_NN_Weber_2015 (1020 mM): Weber G (2015) <doi:10.1093/bioinformatics/btu751>

DNA_NN_Weber_OW04_69 (69 mM), DNA_NN_Weber_OW04_119 (119 mM), DNA_NN_Weber_OW04_220 (220 mM), DNA_NN_Weber_OW04_621 (621 mM), DNA_NN_Weber_OW04_1020 (1020 mM): Weber G (2015) <doi:10.1093/bioinformatics/btu751>

RNA_NN_Weber_VIF_71 (71 mM), RNA_NN_Weber_VIF_121 (121 mM), RNA_NN_Weber_VIF_221 (221 mM), RNA_NN_Weber_VIF_621 (621 mM), RNA_NN_Weber_VIF_1021 (1021 mM): Ferreira I (2019) <doi:10.1016/j.chemphys.2019.01.016>, variable initiation factors

RNA_NN_Weber_FIF_71 (71 mM), RNA_NN_Weber_FIF_121 (121 mM), RNA_NN_Weber_FIF_221 (221 mM), RNA_NN_Weber_FIF_621 (621 mM), RNA_NN_Weber_FIF_1021 (1021 mM): Ferreira I (2019) <doi:10.1016/j.chemphys.2019.01.016>, fixed initiation factors

RNA_DNA_NN_Weber_2019_FT (1000 mM), RNA_DNA_NN_Weber_2019_VH (1000 mM), RNA_DNA_NN_Weber_2019_LS (100 mM): Basilio Barbosa V (2019) <doi:10.1016/j.bpc.2019.106189>

RNA_DNA_NN_Banerjee_2020 (100 mM): Banerjee D (2020) <doi:10.1093/nar/gkaa572>

RNA_NN_Zuber_2022: Zuber J (2022) <doi:10.1093/nar/gkac261>

RNA_NN_Ghosh_2023_PEG200 (100 mM, 40 wt

DNA_NN_Ghosh_2020_PEG200 (100 mM, 40 wt

DNA_TMM_Bommarito_2000: Bommarito S (2000) <doi:10.1093/nar/28.9.1929>

DNA_IMM_Peyret_1999: Peyret N (1999) <doi:10.1021/bi9825091> & Allawi H T (1997) <doi:10.1021/bi962590c> & Santalucia N (2005) <doi:10.1093/nar/gki918>

DNA_DE_Bommarito_2000: Bommarito S (2000) <doi:10.1093/nar/28.9.1929>

RNA_DE_Turner_2010: Turner D H (2010) <doi:10.1093/nar/gkp892>

Value

A TmCalculator list with:

gr

The input GRanges with metadata columns Tm and GC (melting temperature in ^{\circ}C and GC percent). Sequences that could not be evaluated receive NA.

options

The calculation parameters actually used, including the parameter tables and their citations, ion and additive concentrations, Salt correction method, and two fields recording how salt was handled: Salt correction applied (logical) and Parameter set fitted at [Na+] (mM), which is NA for reference-salt sets. Regions skipped for containing N are listed in Skipped regions containing N.

Choosing a parameter set

Parameter sets fall into two families that are handled differently.

The two families are distinguished by one mechanical criterion: a set is condition-specific if and only if it carries a salt_mM attribute.

Reference-salt sets (no salt_mM; Breslauer 1986, Sugimoto 1996, Allawi 1998, SantaLucia 2004, Freier 1986, Xia 1998, Chen 2012, Zuber 2022, Sugimoto 1995) were fitted at a single reference sodium concentration, and other conditions are reached by applying one of the salt_method correction formulas.

Condition-specific sets (the Weber/VarGibbs series, Banerjee 2020, and the molecular-crowding sets of Ghosh 2020 and Ghosh 2023) were instead fitted directly at a stated sodium concentration and are intended to replace salt correction rather than be corrected. When the requested Na matches the set's salt_mM value, salt correction is skipped automatically; when it does not, the correction is still applied but a warning is issued, since correcting an already condition-specific set double-counts the ionic effect. Whether a correction was applied is recorded in the returned options.

As a rule of thumb, pick the set whose fitted salt is closest to your experimental condition rather than correcting a distant one.

Author(s)

Junhui Li

References

Breslauer K J , Frank R , Blocker H , et al. Predicting DNA duplex stability from the base sequence.[J]. Proceedings of the National Academy of Sciences, 1986, 83(11):3746-3750.

Sugimoto N , Nakano S , Yoneyama M , et al. Improved Thermodynamic Parameters and Helix Initiation Factor to Predict Stability of DNA Duplexes[J]. Nucleic Acids Research, 1996, 24(22):4501-5.

Allawi, H. Thermodynamics of internal C.T mismatches in DNA[J]. Nucleic Acids Research, 1998, 26(11):2694-2701.

Hicks L D , Santalucia J . The thermodynamics of DNA structural motifs.[J]. Annual Review of Biophysics & Biomolecular Structure, 2004, 33(1):415-440.

Freier S M , Kierzek R , Jaeger J A , et al. Improved free-energy parameters for predictions of RNA duplex stability.[J]. Proceedings of the National Academy of Sciences, 1986, 83(24):9373-9377.

Xia T , Santalucia , J , Burkard M E , et al. Thermodynamic Parameters for an Expanded Nearest-Neighbor Model for Formation of RNA Duplexes with Watson-Crick Base Pairs,[J]. Biochemistry, 1998, 37(42):14719-14735.

Chen J L , Dishler A L , Kennedy S D , et al. Testing the Nearest Neighbor Model for Canonical RNA Base Pairs: Revision of GU Parameters[J]. Biochemistry, 2012, 51(16):3508-3522.

Bommarito S, Peyret N, Jr S L. Thermodynamic parameters for DNA sequences with dangling ends[J]. Nucleic Acids Research, 2000, 28(9):1929-1934.

Turner D H , Mathews D H . NNDB: the nearest neighbor parameter database for predicting stability of nucleic acid secondary structure[J]. Nucleic Acids Research, 2010, 38(Database issue):D280-D282.

Sugimoto N , Nakano S I , Katoh M , et al. Thermodynamic Parameters To Predict Stability of RNA/DNA Hybrid Duplexes[J]. Biochemistry, 1995, 34(35):11211-11216.

Allawi H, SantaLucia J: Thermodynamics and NMR of internal G-T mismatches in DNA. Biochemistry 1997, 36:10581-10594.

Weber G. Optimization method for obtaining nearest-neighbour DNA entropies and enthalpies directly from melting temperatures. Bioinformatics, 2015, 31(6):871-877.

Ferreira I, Jolley E A, Znosko B M, Weber G. Replacing salt correction factors with optimized RNA nearest-neighbour enthalpy and entropy parameters. Chemical Physics, 2019, 521:69-76.

Basilio Barbosa V, de Oliveira Martins E, Weber G. Nearest-neighbour parameters optimized for melting temperature prediction of DNA/RNA hybrids at high and low salt concentrations. Biophysical Chemistry, 2019, 251:106189.

Banerjee D, Tateishi-Karimata H, Ohyama T, et al. Improved nearest-neighbor parameters for the stability of RNA/DNA hybrids under a physiological condition. Nucleic Acids Research, 2020, 48(21):12042-12054.

Zuber J, Schroeder S J, Sun H, Turner D H, Mathews D H. Nearest neighbor rules for RNA helix folding thermodynamics: improved end effects. Nucleic Acids Research, 2022, 50(9):5251-5262.

Ghosh S, Takahashi S, Ohyama T, et al. Nearest-neighbor parameters for predicting DNA duplex stability in diverse molecular crowding conditions. Proceedings of the National Academy of Sciences, 2020, 117(25):14194-14201.

Ghosh S, Takahashi S, Banerjee D, et al. Nearest-neighbor parameters for the prediction of RNA duplex stability in diverse in vitro and cellular-like crowding conditions. Nucleic Acids Research, 2023, 51(9):4101-4111.

Santalucia N E W J . Nearest-neighbor thermodynamics of deoxyinosine pairs in DNA duplexes[J]. Nucleic Acids Research, 2005, 33(19):6258-67.

Peyret N , Seneviratne P A , Allawi H T , et al. Nearest-Neighbor Thermodynamics and NMR of DNA Sequences with Internal A-A, C-C, G-G, and T-T Mismatches, [J]. Biochemistry, 1999, 38(12):3468-3477.

Weber G. Optimization method for obtaining nearest-neighbour DNA entropies and enthalpies directly from melting temperatures[J]. Bioinformatics, 2015, 31(6):871-877.

Ferreira I, Jolley E A, Znosko B M, et al. Replacing salt correction factors with optimized RNA nearest-neighbour enthalpy and entropy parameters[J]. Chemical Physics, 2019, 521:69-76.

Basilio Barbosa V, de Oliveira Martins E, Weber G. Nearest-neighbour parameters optimized for melting temperature prediction of DNA/RNA hybrids at high and low salt concentrations[J]. Biophysical Chemistry, 2019, 251:106189.

Banerjee D, Tateishi-Karimata H, Ohyama T, Ghosh S, Endoh T, Takahashi S, Sugimoto N. Improved nearest-neighbor parameters for the stability of RNA/DNA hybrids under a physiological condition[J]. Nucleic Acids Research, 2020, 48(21):12042-12054.

Zuber J, Schroeder S J, Sun H, Turner D H, Mathews D H. Nearest neighbor rules for RNA helix folding thermodynamics: improved end effects[J]. Nucleic Acids Research, 2022, 50(9):5251-5262.

Ghosh S, Takahashi S, Banerjee D, Ohyama T, Endoh T, Tateishi-Karimata H, Sugimoto N. Nearest-neighbor parameters for the prediction of RNA duplex stability in diverse in vitro and cellular-like crowding conditions[J]. Nucleic Acids Research, 2023, 51(9):4101-4111.

Ghosh S, Takahashi S, Ohyama T, Endoh T, Tateishi-Karimata H, Sugimoto N. Nearest-neighbor parameters for predicting DNA duplex stability in diverse molecular crowding conditions[J]. Proceedings of the National Academy of Sciences, 2020, 117(25):14194-14201.

See Also

tm_calculate for a single entry point to the nearest-neighbor, GC-content and Wallace methods.

Examples


input_seq <- c("AAAATTTTTTTCCCCCCCCCCCCCCGGGGGGGGGGGGTGTGCGCTGC",
"AAAATTTTTTTCCCCCCCCCCCCCCGGGGGGGGGGGGTGTGCGCTGC")
seqs <- to_genomic_ranges(input_seq)
out <- tm_nn(seqs, Na=50)
out

# A parameter set fitted at a stated sodium concentration. Because Na
# matches the concentration the set was fitted at, salt correction is
# skipped automatically rather than applied on top of it.
out_ls <- tm_nn(seqs, nn_table = "RNA_DNA_NN_Weber_2019_LS", Na = 100)
out_ls$options[["Salt correction applied"]]

# -- A parameter table supplied by the user --------------------------------
# Any of nn_table, tmm_table, imm_table and de_table also accepts a matrix,
# which is how a set the package does not ship, most obviously one covering
# modified bases, is used without waiting for a new release.
#
# Start from a built-in set to get the required keys, then add a stack. The
# key naming follows the built-in convention: top strand, "/", bottom
# strand, so "MG/CG" would be a 5-methylcytosine followed by G, paired with
# CG. The values here are illustrative and are NOT measured parameters.
tbl <- TmCalculator:::get_table("DNA_NN_SantaLucia_2004")
tbl <- rbind(tbl, "MG/CG" = c(-9.1, -24.0))

# Optional attributes. "reference" names the built-in whose key set must be
# present, which matters for RNA and hybrid tables because the default
# reference is a DNA/DNA set. "salt_mM" marks the table as fitted at a
# stated sodium concentration, so that it suppresses the salt correction at
# that concentration exactly as the built-in condition-specific sets do.
attr(tbl, "reference") <- "DNA_NN_SantaLucia_2004"

out_user <- tm_nn(seqs, nn_table = tbl, Na = 50)
out_user$options[["Thermodynamic NN values"]]
# "user-supplied (reference: DNA_NN_SantaLucia_2004)"

# Passing a built-in table back in through this route changes nothing: the
# supplied table is reordered to the reference key order before use, so row
# order carries no information.
identical(tm_nn(seqs, nn_table = "DNA_NN_SantaLucia_2004")$gr$Tm,
          tm_nn(seqs,
                nn_table = TmCalculator:::get_table("DNA_NN_SantaLucia_2004")
                )$gr$Tm)

# A table missing a key is refused rather than tolerated. The compiled core
# resolves each stack by name, so an absent key would contribute zero
# enthalpy and entropy to every sequence containing that step, silently.
try(tm_nn(seqs, nn_table = tbl[setdiff(rownames(tbl), "AA/TT"), ]))
out_ls$options[["Parameter set fitted at [Na+] (mM)"]]


Calculate the melting temperature using the 'Wallace rule'

Description

The Wallace rule is often used as rule of thumb for approximate melting temperature calculations for primers with 14 to 20 nt length.

Usage

tm_wallace(gr_seq, ambiguous = FALSE)

Arguments

gr_seq

Pre-processed sequence(s) in 5' to 3' direction. This should be the output from to_genomic_ranges() function.

ambiguous

Ambiguous bases are taken into account to compute the G and C content when ambiguous is TRUE.

Value

Returns a list of sequences with updated Tm attributes

Length of validity

The 2 + 4 rule was calibrated on 14 to 20 nt hybridisation probes and carries no length-dependent, salt-dependent or concentration-dependent term. Its error therefore grows without bound as sequences lengthen, and on genome-scale windows it returns a number that is not a melting temperature in any useful sense: a 200 bp window is reported at several hundred degrees Celsius.

Sequences longer than 30 nt raise a warning that names tm_nn as the appropriate alternative. A warning rather than an error, because the rule stays a legitimate rule of thumb and users who knowingly apply it outside its calibrated range should not be blocked; wrap the call in suppressWarnings() in that case.

Author(s)

Junhui Li

References

Thein S L , Lynch J R , Weatherall D J , et al. DIRECT DETECTION OF HAEMOGLOBIN E WITH SYNTHETIC OLIGONUCLEOTIDES[J]. The Lancet, 1986, 327(8472):93.

Examples


input_seq = c('acgtTGCAATGCCGTAWSDBSY','acgtTGCCCCGGCCGCGCCGTAWSDBSY') #for wallace rule
gr_seq <- to_genomic_ranges(input_seq)
out <- tm_wallace(gr_seq, ambiguous = TRUE)
out
out$Options


Convert input sequences to a GRanges object (fast backend)

Description

Drop-in replacement for to_genomic_ranges that uses the fast coordinate backend in coor_to_genomic_ranges for genomic coordinate input. Accepts the same input_seq and complement_seq arguments as to_genomic_ranges, plus a list input list(pkg_name = ..., seq = ...) for large tiling jobs.

This function processes a vector of sequences string, a FASTA file, or a character vector with genomic coordinates into a GenomicRanges object, optionally including complementary sequences. sequence names are parsed based on their format: - If names have this pattern "chr:start-end:strand:species[:name]" (e.g., "chr1:1-5:+:seq_1"), parse components into seqnames, ranges, strand, and name. - If names have this pattern "chr:start-end:strand" (e.g., "chr1:1-5:+"), parse components into seqnames, ranges, and strand. - If names have this pattern "chr:start-end" (e.g., "chr1:1-5"), parse components into seqnames and ranges. - If no names are provided, use default values: seqnames = "chr1", start = 1, width = sequence length, strand = "*", name = "1", etc. Complementary sequences are either provided or automatically generated.

Usage

to_genomic_ranges_fast(
  input_seq,
  complement_seq = NULL,
  method = c("vectorized", "preload_chr")
)

to_genomic_ranges(input_seq, complement_seq = NULL)

Arguments

input_seq

Input sequence(s) in 5' to 3' direction. Can be provided as either: - A character string (e.g., c("ATGCG", "GCTAG")) - A path to a FASTA file containing the sequence(s) - A character vector where each element is a string in the format "chr:start-end:strand:species" #' (e.g., "chr1:100-200:+:BSgenome.Hsapiens.UCSC.hg38"). Strand is "+" for positive or "-" for negative. - chr: Chromosome ID - start: Start position - end: End position - strand: positive or negative strand - species: Species name for reference genome (e.g., "BSgenome.Hsapiens.UCSC.hg38"), see BSgenome::available.genomes() for all available genomes. please make sure the genome package is installed, otherwise the function will stop.

complement_seq

Optional complementary sequences. If NULL, complementary sequences will be auto-generated. otherwise, the complementary sequences will be used as metadata. Can be provided as format of input_seq.

method

Sequence extraction method passed to coor_to_genomic_ranges. One of "vectorized" (default) or "preload_chr".

Value

A GRanges object. See coor_to_genomic_ranges for metadata columns when coordinate input is used.

A GenomicRanges object with seqnames, ranges, strand, name, sequence, Complement, and Tm as metadata.

Author(s)

Junhui Li

Examples

## Not run: 
gr <- to_genomic_ranges_fast(
  list(
    pkg_name = "BSgenome.Hsapiens.UCSC.hg38",
    seq = c("chr1:1000-1199:+:win1", "chr1:1200-1399:+:win2")
  )
)

## End(Not run)

# Using a character vector with auto-generated complementary sequences
seqs <- c("ATGCG", "GCTAG")
names(seqs) <- c("chr1:1-5:+:seq_1", "chr2:1-5:+")
gr <- to_genomic_ranges(seqs)
gr

# Using a character vector with provided complementary sequences
seqs <- c("ATGCG", "GCTAG")
comp_seqs <- c("TACGC", "CGTA")
gr <- to_genomic_ranges(seqs, comp_seqs)
gr

# Using a FASTA file
gr <- to_genomic_ranges(system.file("extdata", "example1.fasta", package = "TmCalculator"))
## Not run: 
# Using a character vector with genomic coordinates
seqs <- c(
  "chr1:1898000-1898050:+:BSgenome.Hsapiens.UCSC.hg38",
  "chr2:2563000-2563050:-:BSgenome.Hsapiens.UCSC.hg38"
)
gr <- to_genomic_ranges(seqs)
gr

## End(Not run)


Convert sequence strings to GenomicRanges object

Description

This function converts sequence strings to a GenomicRanges object, handling both named and unnamed sequences. It can also process complementary sequences if provided. sequence names can be in the format ">chr2:1-10:+:seq2" which will be parsed into chromosome, position, strand, and name components.

Usage

vec_to_genomic_ranges(input_seq)

Arguments

input_seq

A character vector of sequences. If named with format "chr2:1-10:[+|-]:[seq_name]" the name will be parsed into GRanges components.

Value

A GenomicRanges object containing: - GRanges information (seqnames, ranges, strand) - sequence data - Complementary sequences - Names from input or auto-generated

Examples

# Example with named sequences in GRanges format
seqs <- c("ATGCG", "GCTAG")
names(seqs) <- c("chr1:1111-1115:+:seq1", "chr2:1221-1225:+")
gr <- vec_to_genomic_ranges(seqs)

# Example with unnamed sequences
seqs <- c("ATGCG", "GCTAG")
gr <- vec_to_genomic_ranges(seqs)