| Type: | Package |
| Version: | 1.5.0 |
| Date: | 2026-09-28 |
| Title: | Immunoglobulin Clonal Lineage and Diversity Analysis |
| Description: | Provides methods for high-throughput adaptive immune receptor repertoire sequencing (AIRR-Seq; Rep-Seq) analysis. In particular, immunoglobulin (Ig) sequence lineage reconstruction, lineage topology analysis, diversity profiling, amino acid property analysis and gene usage. Citations: Gupta and Vander Heiden, et al (2017) <doi:10.1093/bioinformatics/btv359>, Stern, Yaari and Vander Heiden, et al (2014) <doi:10.1126/scitranslmed.3008879>. |
| License: | AGPL-3 |
| URL: | https://alakazam.readthedocs.io/ |
| BugReports: | https://github.com/immcantation/alakazam/issues |
| LazyData: | true |
| BuildVignettes: | true |
| VignetteBuilder: | knitr, rmarkdown |
| Encoding: | UTF-8 |
| LinkingTo: | Rcpp |
| biocViews: | Software, AnnotationData |
| Depends: | R (≥ 4.0), ggplot2 (≥ 3.4.0) |
| Imports: | airr (≥ 1.4.1), ape, dplyr (≥ 1.0), graphics, grid, igraph (≥ 1.5.0), Matrix (≥ 1.3-0), methods, progress, Rcpp (≥ 0.12.12), readr, rlang, scales, seqinr, stats, stringi, tibble, tidyr (≥ 1.0), utils, Biostrings (≥ 2.56.0), GenomicAlignments (≥ 1.24.0), IRanges (≥ 2.22.2) |
| Suggests: | cigarillo, knitr, rmarkdown, testthat |
| Collate: | 'Alakazam.R' 'AminoAcids.R' 'Classes.R' 'Core.R' 'Data.R' 'Diversity.R' 'Deprecated.R' 'Fastq.R' 'Gene.R' 'Lineage.R' 'RcppExports.R' 'Sequence.R' 'Topology.R' |
| Config/roxygen2/version: | 8.1.0 |
| NeedsCompilation: | yes |
| Packaged: | 2026-09-28 19:27:01 UTC; root |
| Author: | Susanna Marquez [cre, aut], Namita Gupta [aut], Nima Nouri [aut], Ruoyi Jiang [aut], Julian Zhou [aut], Kenneth Hoehn [aut], Daniel Gadala-Maria [ctb], Edel Aron [ctb], Cole Jensen [aut], Gisela Gabernet [ctb], Caroline Sullivan [ctb], Hailong Meng [ctb], Huimin Lyu [ctb], Burhan Sabuwala [ctb], Jason Vander Heiden [aut], Steven Kleinstein [aut, cph] |
| Maintainer: | Susanna Marquez <susanna.marquez@yale.edu> |
| Repository: | CRAN |
| Date/Publication: | 2026-09-28 23:40:08 UTC |
alakazam: Immunoglobulin Clonal Lineage and Diversity Analysis
Description
Provides methods for high-throughput adaptive immune receptor repertoire sequencing (AIRR-Seq; Rep-Seq) analysis. In particular, immunoglobulin (Ig) sequence lineage reconstruction, lineage topology analysis, diversity profiling, amino acid property analysis and gene usage. Citations: Gupta and Vander Heiden, et al (2017) doi:10.1093/bioinformatics/btv359, Stern, Yaari and Vander Heiden, et al (2014) doi:10.1126/scitranslmed.3008879.
Author(s)
Maintainer: Susanna Marquez susanna.marquez@yale.edu
Authors:
Susanna Marquez susanna.marquez@yale.edu
Namita Gupta namita.gupta@yale.edu
Nima Nouri nima.nouri@yale.edu
Ruoyi Jiang ruoyi.jiang@yale.edu
Julian Zhou julian.zhou@bulldogs.yale.edu
Kenneth Hoehn kenneth.hoehn@yale.edu
Cole Jensen cole.jensen@yale.edu
Jason Vander Heiden jason.vanderheiden@gmail.com
Steven Kleinstein steven.kleinstein@yale.edu [copyright holder]
Other contributors:
Daniel Gadala-Maria daniel.gadala-maria@yale.edu [contributor]
Edel Aron edel.aron@yale.edu [contributor]
Gisela Gabernet gisela.gabernet@yale.edu [contributor]
Caroline Sullivan caroline.sullivan@yale.edu [contributor]
Hailong Meng hailong.meng@yale.edu [contributor]
Huimin Lyu huimin.lyu@yale.edu [contributor]
Burhan Sabuwala burhan.sabuwala@yale.edu [contributor]
See Also
Useful links:
Amino acid abbreviation translations
Description
Mappings of amino acid abbreviations.
Usage
ABBREV_AA
Format
Named character vector defining single-letter character codes to three-letter abbreviation mappings.
Examples
aa <- c("Ala", "Ile", "Trp")
translateStrings(aa, ABBREV_AA)
S4 class defining a clonal abundance curve
Description
AbundanceCurve defines clonal abundance values.
Usage
## S4 method for signature 'AbundanceCurve'
print(x)
## S4 method for signature 'AbundanceCurve,missing'
plot(x, y, ...)
Arguments
x |
AbundanceCurve object |
y |
ignored. |
... |
arguments to pass to plotDiversityCurve. |
Slots
abundancedata.frame with relative clonal abundance data and confidence intervals, containing the following columns:
-
group: group identifier. -
clone_idorCLONE: clone identifier. -
p: relative abundance of the clone. -
lower: lower confidence interval bound. -
upper: upper confidence interval bound. -
rank: the rank of the clone abundance.
-
bootstrapdata.frame of bootstrapped clonal distributions.
clone_bystring specifying the name of the clone column.
group_bystring specifying the name of the grouping column.
groupsvector specifying the names of unique groups in group column.
nnumeric vector indication the number of sequences sampled in each group.
nbootnumeric specifying the number of bootstrap iterations to use.
ciconfidence interval defining the upper and lower bounds (a value between 0 and 1).
S4 class defining a clone
Description
ChangeoClone defines a common data structure for perform lineage reconstruction
from Change-O data.
Slots
datadata.frame containing sequences and annotations. Contains the columns
SEQUENCE_IDandSEQUENCE, as well as any additional sequence-specific annotation columns.clonestring defining the clone identifier.
germlinestring containing the germline sequence for the clone.
v_genestring defining the V segment gene call.
j_genestring defining the J segment gene call.
junc_lennumeric junction length (nucleotide count).
See Also
See makeChangeoClone and buildPhylipLineage for use.
Default colors
Description
Default color palettes for DNA characters, Ig isotypes, and TCR chains.
Usage
DNA_COLORS
IG_COLORS
TR_COLORS
Format
Named character vectors with hexcode colors as values.
-
DNA_COLORS: DNA character colorsc("A", "C", "G", "T"). -
IG_COLORS: Ig isotype colorsc("IGHA", "IGHD", "IGHE", "IGHG", "IGHM", "IGHK", "IGHL"). -
TR_COLORS: TCR chain colorsc("TRA", "TRB", "TRD", "TRG").
Examples
# IG_COLORS as an isotype color set for ggplot
isotype <- c("IGHG", "IGHM", "IGHM", "IGHA")
db <- data.frame(x=1:4, y=1:4, iso=isotype)
g1 <- ggplot(db, aes(x=x, y=y, color=iso)) +
scale_color_manual(name="Isotype", values=IG_COLORS) +
geom_point(size=10)
plot(g1)
# DNA_COLORS to translate nucleotide values to a vector of colors
# for use in base graphics plots
seq <- c("A", "T", "T", "C")
colors <- translateStrings(seq, setNames(names(DNA_COLORS), DNA_COLORS))
plot(1:4, 1:4, col=colors, pch=16, cex=6)
S4 class defining a diversity curve
Description
DiversityCurve defines diversity (D) scores over multiple diversity
orders (Q).
Usage
## S4 method for signature 'DiversityCurve'
print(x)
## S4 method for signature 'DiversityCurve,missing'
plot(x, y, ...)
## S4 method for signature 'DiversityCurve,numeric'
plot(x, y, ...)
Arguments
x |
DiversityCurve object |
y |
diversity order to plot (q). |
... |
arguments to pass to plotDiversityCurve or plotDiversityTest. |
Slots
diversitydata.frame defining the diversity curve with the following columns:
-
group: group label. -
q: diversity order. -
d: mean diversity index over all bootstrap realizations. -
d_sd: standard deviation of the diversity index over all bootstrap realizations. -
d_lower: diversity lower confidence interval bound. -
d_upper: diversity upper confidence interval bound. -
e: evenness index calculated asDdivided byDatQ=0. -
e_lower: evenness lower confidence interval bound. -
e_upper: evenness upper confidence interval bound.
-
testsdata.frame describing the significance test results with columns:
-
test: string listing the two groups tested. -
delta_mean: mean of theDbootstrap delta distribution for the test. -
delta_sd: standard deviation of theDbootstrap delta distribution for the test. -
pvalue: p-value for the test.
-
group_bystring specifying the name of the grouping column in diversity calculation.
groupsvector specifying the names of unique groups in group column in diversity calculation.
methodstring specifying the type of diversity calculated.
qvector of diversity hill diversity indices used for computing diversity.
nnumeric vector indication the number of sequences sampled in each group.
ciconfidence interval defining the upper and lower bounds (a value between 0 and 1).
S4 class defining edge significance
Description
EdgeTest defines the significance of parent-child annotation enrichment.
Usage
## S4 method for signature 'EdgeTest'
print(x)
## S4 method for signature 'EdgeTest,missing'
plot(x, y, ...)
Arguments
x |
EdgeTest object. |
y |
ignored. |
... |
arguments to pass to plotEdgeTest. |
Slots
testsdata.frame describing the significance test results with columns:
-
parent: parent node annotation. -
child: child node annotation -
count: count of observed edges with the given parent-child annotation set. -
expected: mean count of expected edges for the given parent-child relationship. -
pvalue: one-sided p-value for the hypothesis that the observed edge abundance is greater than expected.
-
permutationsdata.frame containing the raw permutation test data with columns:
-
parent: parent node annotation. -
child: child node annotation -
count: count of edges with the given parent-child annotation set. -
iter: numerical index define which permutation realization each observation corresponds to.
-
npermnumber of permutation realizations.
Small example 10x Genomics Ig V(D)J sequences from CD19+ B cells isolated from PBMCs of a healthy human donor. Down-sampled from data provided by 10x Genomics under a Creative Commons Attribute license, and processed with their Cell Ranger pipeline.
Description
Small example 10x Genomics Ig V(D)J sequences from CD19+ B cells isolated from PBMCs of a healthy human donor. Down-sampled from data provided by 10x Genomics under a Creative Commons Attribute license, and processed with their Cell Ranger pipeline.
Usage
Example10x
Format
A data.frame with the following AIRR style columns:
-
sequence_id: Sequence identifier -
sequence_alignment: IMGT-gapped observed sequence. -
germline_alignment: IMGT-gapped germline sequence. -
v_call: V region allele assignments. -
d_call: D region allele assignments. -
j_call: J region allele assignments. -
c_call: Isotype (C region) assignment. -
junction: Junction region sequence. -
junction_length: Length of the junction region in nucleotides. -
np1_length: Combined length of the N and P regions proximal to the V region. -
np2_length: Combined length of the N and P regions proximal to the J region. -
umi_count: Number of unique molecular identifies atttributed to sequence. -
cell_id: Cell identifier. -
locus: Genomic locus of sequence.
References
Data source: https://support.10xgenomics.com/single-cell-vdj/datasets/2.2.0/vdj_v1_hs_cd19_b
License: https://creativecommons.org/licenses/by/4.0/
Example AIRR database
Description
A small example database subset from Laserson and Vigneault et al, 2014.
Usage
ExampleDb
Format
A data.frame with the following AIRR style columns:
-
sequence_id: Sequence identifier -
sequence_alignment: IMGT-gapped observed sequence. -
germline_alignment: IMGT-gapped germline sequence. -
germline_alignment_d_mask: IMGT-gapped germline sequence with N, P and D regions masked. -
v_call: V region allele assignments. -
v_call_genotyped: TIgGER corrected V region allele assignment. -
d_call: D region allele assignments. -
j_call: J region allele assignments. -
c_call: Isotype (C region) assignment. -
junction: Junction region sequence. -
junction_length: Length of the junction region in nucleotides. -
np1_length: Combined length of the N and P regions proximal to the V region. -
np2_length: Combined length of the N and P regions proximal to the J region. -
duplicate_count: Copy count (number of duplicates) of the sequence. -
clone_id: Change-O assignment clonal group identifier. -
sample_id: Sample identifier. Time in relation to vaccination.
References
Laserson U and Vigneault F, et al. High-resolution antibody dynamics of vaccine-induced immune responses. Proc Natl Acad Sci USA. 2014 111:4928-33.
See Also
Example Change-O database
Description
A small example database subset from Laserson and Vigneault et al, 2014.
Usage
ExampleDbChangeo
Format
A data.frame with the following Change-O style columns:
-
SEQUENCE_ID: Sequence identifier -
SEQUENCE_IMGT: IMGT-gapped observed sequence. -
GERMLINE_IMGT_D_MASK: IMGT-gapped germline sequence with N, P and D regions masked. -
V_CALL: V region allele assignments. -
V_CALL_GENOTYPED: TIgGER corrected V region allele assignment. -
D_CALL: D region allele assignments. -
J_CALL: J region allele assignments. -
JUNCTION: Junction region sequence. -
JUNCTION_LENGTH: Length of the junction region in nucleotides. -
NP1_LENGTH: Combined length of the N and P regions proximal to the V region. -
NP2_LENGTH: Combined length of the N and P regions proximal to the J region. -
SAMPLE: Sample identifier. Time in relation to vaccination. -
ISOTYPE: Isotype assignment. -
DUPCOUNT: Copy count (number of duplicates) of the sequence. -
CLONE: Change-O assignment clonal group identifier.
References
Laserson U and Vigneault F, et al. High-resolution antibody dynamics of vaccine-induced immune responses. Proc Natl Acad Sci USA. 2014 111:4928-33.
See Also
Example Ig lineage trees
Description
A set of Ig lineage trees generated from the ExampleDb file, subset to
only those trees with at least four nodes.
Usage
ExampleTrees
Format
A list of igraph objects output by buildPhylipLineage. Each node of each tree has the following annotations (vertex attributes):
-
sample_id: Sample identifier(s). Time in relation to vaccination. -
c_call: Isotype assignment(s). -
duplication_count: Copy count (number of duplicates) of the sequence.
See Also
IMGT V-segment regions
Description
A list defining the boundaries of V-segment framework regions (FWRs) and complementarity determining regions (CDRs) for IMGT-gapped immunoglobulin (Ig) nucleotide sequences according to the IMGT numbering scheme.
Usage
IMGT_REGIONS
Format
A list with regions named one of c("fwr1", "cdr1", "fwr2", "cdr2", "fwr3")
with values containing a numeric vector of length two defining the
c(start, end) positions of the named region.
References
IUPAC ambiguous characters
Description
A translation list mapping IUPAC ambiguous characters code to corresponding nucleotide amino acid characters.
Usage
IUPAC_DNA
IUPAC_AA
DNA_IUPAC
Format
A list with single character codes as names and values containing character vectors that define the set of standard characters that match to each each ambiguous character.
-
IUPAC_DNA: DNA ambiguous character translations. -
IUPAC_AA: Amino acid ambiguous character translations. -
DNA_IUPAC: Ordered DNA to ambiguous characters
S4 class defining edge significance
Description
MRCATest defines the significance of enrichment for annotations appearing at
the MRCA of the tree.
Usage
## S4 method for signature 'MRCATest'
print(x)
## S4 method for signature 'MRCATest,missing'
plot(x, y, ...)
Arguments
x |
MRCATest object. |
y |
ignored. |
... |
arguments to pass to plotMRCATest. |
Slots
testsdata.frame describing the significance test results with columns:
-
annotation: annotation value. -
count: observed count of MRCA positions with the given annotation. -
expected: expected mean count of MRCA occurrence for the annotation. -
pvalue: one-sided p-value for the hypothesis that the observed annotation abundance is greater than expected.
-
permutationsdata.frame containing the raw permutation test data with columns:
-
annotation: annotation value. -
count: count of MRCA positions with the given annotation. -
iter: numerical index define which permutation realization each observation corresponds to.
-
npermnumber of permutation realizations.
Single sequence AIRR database
Description
A database with just one sequence from ExampleDb and additional AIRR Rearrangement fields
containing alignment information. The sequence was reanalyzed with a recent versions of
alignment software (IgBLAST 1.16.0) and reference germlines (IMGT 2020-08-12).
Usage
SingleDb
Format
An object of class spec_tbl_df (inherits from tbl_df, tbl, data.frame) with 1 rows and 32 columns.
See Also
The Alakazam package
Description
alakazam in a member of the Immcantation framework of tools and serves five main
purposes:
Providing core functionality for other R packages in Immcantation. This includes common tasks such as file I/O, basic DNA sequence manipulation, and interacting with V(D)J segment and gene annotations.
Providing an R interface for interacting with the output of the pRESTO and Change-O tool suites.
Performing clonal abundance and diversity analysis on lymphocyte repertoires.
Performing lineage reconstruction on clonal populations of immunoglobulin (Ig) sequences.
Performing physicochemical property analyses of lymphocyte receptor sequences.
For additional details regarding the use of the alakazam package see the
vignettes:
browseVignettes("alakazam")
File I/O
-
readChangeoDb: Input Change-O style files.
-
writeChangeoDb: Output Change-O style files.
Sequence cleaning
-
maskSeqEnds: Mask ragged ends.
-
maskSeqGaps: Mask gap characters.
-
collapseDuplicates: Remove duplicate sequences.
Lineage reconstruction
-
makeChangeoClone: Clean sequences for lineage reconstruction.
-
buildPhylipLineage: Perform lineage reconstruction of Ig sequences.
Lineage topology analysis
-
tableEdges: Tabulate annotation relationships over edges.
-
testEdges: Significance testing of annotation edges.
-
testMRCA: Significance testing of MRCA annotations.
-
summarizeSubtrees: Various summary statistics for subtrees.
-
plotSubtrees: Plot distributions of summary statistics for a population of trees.
Diversity analysis
-
countClones: Calculate clonal abundance.
-
estimateAbundance: Bootstrap clonal abundance curves.
-
alphaDiversity: Generate clonal alpha diversity curves.
-
plotAbundanceCurve: Plot clone size distribution as a rank-abundance
-
plotDiversityCurve: Plot clonal diversity curves.
-
plotDiversityTest: Plot testing at given diversity hill indices.
Ig and TCR sequence annotation
-
countGenes: Calculate Ig and TCR allele, gene and family usage.
-
extractVRegion: Extract CDRs and FWRs sub-sequences.
-
getAllele: Get V(D)J allele names.
-
getGene: Get V(D)J gene names.
-
getFamily: Get V(D)J family names.
-
junctionAlignment: Junction alignment properties
Sequence distance calculation
-
seqDist: Calculate Hamming distance between two sequences.
-
seqEqual: Test two sequences for equivalence.
-
pairwiseDist: Calculate a matrix of pairwise Hamming distances for a set of sequences.
-
fastDist: Faster calculation of pairwise distances between sequences of the same length and contain only "ACTGN?"
-
pairwiseEqual: Calculate a logical matrix of pairwise equivalence for a set of sequences.
Amino acid properties
-
translateDNA: Translate DNA sequences to amino acid sequences.
-
aminoAcidProperties: Calculate various physicochemical properties of amino acid sequences.
-
countPatterns: Count patterns in sequences.
References
Vander Heiden JA, Yaari G, et al. pRESTO: a toolkit for processing high-throughput sequencing raw reads of lymphocyte receptor repertoires. Bioinformatics. 2014 30(13):1930-2.
Stern JNH, Yaari G, Vander Heiden JA, et al. B cells populating the multiple sclerosis brain mature in the draining cervical lymph nodes. Sci Transl Med. 2014 6(248):248ra107.
Wu Y-CB, et al. Influence of seasonal exposure to grass pollen on local and peripheral blood IgE repertoires in patients with allergic rhinitis. J Allergy Clin Immunol. 2014 134(3):604-12.
Gupta NT, Vander Heiden JA, et al. Change-O: a toolkit for analyzing large-scale B cell immunoglobulin repertoire sequencing data. Bioinformatics. 2015 Oct 15;31(20):3356-8.
Calculates the aliphatic index of amino acid sequences
Description
aliphatic calculates the aliphatic index of amino acid sequences using
the method of Ikai. Non-informative positions are excluded, where non-informative
is defined as any character in c("X", "-", ".", "*").
Usage
aliphatic(seq, normalize = TRUE)
Arguments
seq |
vector of strings containing amino acid sequences. |
normalize |
if |
Value
A vector of the aliphatic indices for the sequence(s).
References
Ikai AJ. Thermostability and aliphatic index of globular proteins. J Biochem. 88, 1895-1898 (1980).
Examples
seq <- c("CARDRSTPWRRGIASTTVRTSW", NA, "XXTQMYVRT")
aliphatic(seq)
Calculate clonal alpha diversity
Description
alphaDiversity takes in a data.frame or AbundanceCurve and computes
diversity scores (D) over an interval of diversity orders (q).
Usage
alphaDiversity(data, min_q = 0, max_q = 4, step_q = 0.1, ci = 0.95, ...)
Arguments
data |
data.frame with Change-O style columns containing clonal assignments or a AbundanceCurve generate by estimateAbundance object containing a previously calculated bootstrap distributions of clonal abundance. |
min_q |
minimum value of |
max_q |
maximum value of |
step_q |
value by which to increment |
ci |
confidence interval to calculate; the value must be between 0 and 1. |
... |
additional arguments to pass to estimateAbundance. Additional arguments are ignored if a AbundanceCurve is provided as input. |
Details
Clonal diversity is calculated using the generalized diversity index (Hill numbers) proposed by Hill (Hill, 1973). See calcDiversity for further details.
To generate a smooth curve, D is calculated for each value of q from
min_q to max_q incremented by step_q. When uniform=TRUE
variability in total sequence counts across unique values in the group column
is corrected by repeated resampling from the estimated complete clonal distribution to a
common number of sequences. The complete clonal abundance distribution that is resampled
from is inferred by using the Chao1 estimator to infer the number of unseen clones,
followed by applying the relative abundance correction and unseen clone frequencies
described in Chao et al, 2015.
The diversity index (D) for each group is the mean value of over all resampling
realizations. Confidence intervals are derived using the standard deviation of the
resampling realizations, as described in Chao et al, 2015.
Significance of the difference in diversity index (D) between groups is tested by
constructing a bootstrap delta distribution for each pair of unique values in the
group column. The bootstrap delta distribution is built by subtracting the diversity
index Da in group a from the corresponding value Db in group b,
for all bootstrap realizations, yielding a distribution of nboot total deltas; where
group a is the group with the greater mean D. The p-value for hypothesis
Da != Db is the value of P(0) from the empirical cumulative distribution
function of the bootstrap delta distribution, multiplied by 2 for the two-tailed correction.
Note, this method may inflate statistical significance when clone sizes are uniformly small,
such as when most clones sizes are 1, sample size is small, and max_n is near
the total count of the smallest data group. Use caution when interpreting the results
in such cases.
Value
A DiversityCurve object summarizing the diversity scores.
References
Hill M. Diversity and evenness: a unifying notation and its consequences. Ecology. 1973 54(2):427-32.
Chao A. Nonparametric Estimation of the Number of Classes in a Population. Scand J Stat. 1984 11, 265270.
Chao A, et al. Rarefaction and extrapolation with Hill numbers: A framework for sampling and estimation in species diversity studies. Ecol Monogr. 2014 84:45-67.
Chao A, et al. Unveiling the species-rank abundance distribution by generalizing the Good-Turing sample coverage theory. Ecology. 2015 96, 11891201.
See Also
See calcDiversity for the basic calculation and DiversityCurve for the return object. See plotDiversityCurve for plotting the return object.
Examples
# Group by sample identifier in two steps
set.seed(123)
abund <- estimateAbundance(ExampleDb, group="sample_id", nboot=100)
div <- alphaDiversity(abund, step_q=1, max_q=10)
plotDiversityCurve(div, legend_title="Sample")
# Grouping by isotype rather than sample identifier in one step
div <- alphaDiversity(ExampleDb, group="c_call", min_n=40, step_q=1, max_q=10,
nboot=100)
plotDiversityCurve(div, legend_title="Isotype")
Calculates amino acid chemical properties for sequence data
Description
aminoAcidProperties calculates amino acid sequence physicochemical properties, including
length, hydrophobicity, bulkiness, polarity, aliphatic index, net charge, acidic residue
content, basic residue content, and aromatic residue content.
Usage
aminoAcidProperties(
data,
property = c("length", "gravy", "bulk", "aliphatic", "polarity", "charge", "basic",
"acidic", "aromatic"),
seq = "junction",
nt = TRUE,
trim = FALSE,
label = NULL,
...
)
Arguments
data |
|
property |
vector strings specifying the properties to be calculated. Defaults to calculating all defined properties. |
seq |
|
nt |
boolean, TRUE if the sequences (or sequence) are DNA and will be translated. |
trim |
if |
label |
name of sequence region to add as prefix to output column names. |
... |
additional named arguments to pass to the functions gravy, bulk, aliphatic, polar or charge. |
Details
For all properties except for length, non-informative positions are excluded,
where non-informative is defined as any character in c("X", "-", ".", "*").
The scores for gravy, bulkiness and polarity are calculated as simple averages of the scores for each informative positions. The basic, acid and aromatic indices are calculated as the fraction of informative positions falling into the given category.
The aliphatic index is calculated using the Ikai, 1980 method.
The net charge is calculated using the method of Moore, 1985, excluding the N-terminus and C-terminus charges, and normalizing by the number of informative positions. The default pH for the calculation is 7.4.
The following data sources were used for the default property scores:
hydropathy: Kyte & Doolittle, 1982.
bulkiness: Zimmerman et al, 1968.
polarity: Grantham, 1974.
pK: EMBOSS.
Value
A modified data data.frame with the following columns:
-
*_aa_length: number of amino acids. -
*_aa_gravy: grand average of hydrophobicity (gravy) index. -
*_aa_bulk: average bulkiness of amino acids. -
*_aa_aliphatic: aliphatic index. -
*_aa_polarity: average polarity of amino acids. -
*_aa_charge: net charge. -
*_aa_basic: fraction of informative positions that are Arg, His or Lys. -
*_aa_acidic: fraction of informative positions that are Asp or Glu. -
*_aa_aromatic: fraction of informative positions that are His, Phe, Trp or Tyr.
Where * is the value from label or the name specified for
seq if label=NULL.
References
Zimmerman JM, Eliezer N, Simha R. The characterization of amino acid sequences in proteins by statistical methods. J Theor Biol 21, 170-201 (1968).
Grantham R. Amino acid difference formula to help explain protein evolution. Science 185, 862-864 (1974).
Ikai AJ. Thermostability and aliphatic index of globular proteins. J Biochem 88, 1895-1898 (1980).
Kyte J, Doolittle RF. A simple method for displaying the hydropathic character of a protein. J Mol Biol 157, 105-32 (1982).
Moore DS. Amino acid and peptide net charges: A simple calculational procedure. Biochem Educ 13, 10-11 (1985).
Wu YC, et al. High-throughput immunoglobulin repertoire analysis distinguishes between human IgM memory and switched memory B-cell populations. Blood 116, 1070-8 (2010).
Wu YC, et al. The relationship between CD27 negative and positive B cell populations in human peripheral blood. Front Immunol 2, 1-12 (2011).
-
https://emboss.sourceforge.net/apps/cvs/emboss/apps/iep.html
See Also
See countPatterns for counting the occurrence of specific amino acid subsequences. See gravy, bulk, aliphatic, polar and charge for functions that calculate the included properties individually.
Examples
# Subset example data
db <- ExampleDb[c(1,10,100), c("sequence_id", "junction")]
# Calculate default amino acid properties from DNA sequences
aminoAcidProperties(db, seq="junction")
# Calculate default amino acid properties from amino acid sequences
# Use a custom output column prefix
db$junction_aa <- translateDNA(db$junction)
aminoAcidProperties(db, seq="junction_aa", label="junction", nt=FALSE)
# Use the Grantham, 1974 side chain volume scores from the seqinr package
# Set pH=7.0 for the charge calculation
# Calculate only average volume and charge
# Remove the head and tail amino acids from the junction, thus making it the CDR3
library(seqinr)
data(aaindex)
x <- aaindex[["GRAR740103"]]$I
# Rename the score vector to use single-letter codes
names(x) <- translateStrings(names(x), ABBREV_AA)
# Calculate properties
aminoAcidProperties(db, property=c("bulk", "charge"), seq="junction",
trim=TRUE, label="cdr3", bulkiness=x, pH=7.0)
Standard ggplot settings
Description
baseTheme defines common ggplot theme settings for plotting.
Usage
baseTheme(sizing = c("figure", "window"))
Arguments
sizing |
defines the style and sizing of the theme. One of
|
Value
A ggplot2 object.
See Also
Infer an Ig lineage using PHYLIP
Description
buildPhylipLineage reconstructs an Ig lineage via maximum parsimony using the
dnapars application, or maximum likelihood using the dnaml application of the PHYLIP package.
Note: To use the most recent methods for building, visualizing and analyzing
trees, use the R package [Dowser](https://dowser.readthedocs.io).
Usage
buildPhylipLineage(
clone,
phylip_exec,
dist_mat = getDNAMatrix(gap = 0),
rm_temp = FALSE,
verbose = FALSE,
temp_path = NULL,
onetree = FALSE,
branch_length = c("mutations", "distance")
)
Arguments
clone |
ChangeoClone object containing clone data. |
phylip_exec |
absolute path to the PHYLIP dnapars executable. |
dist_mat |
character distance matrix to use for reassigning edge weights.
Defaults to a Hamming distance matrix returned by getDNAMatrix
with |
rm_temp |
if |
verbose |
if |
temp_path |
specific path to temp directory if desired. |
onetree |
if |
branch_length |
specifies how to define branch lengths; one of |
Details
buildPhylipLineage builds the lineage tree of a set of unique Ig sequences via
maximum parsimony through an external call to the dnapars application of the PHYLIP
package. dnapars is called with default algorithm options, except for the search option,
which is set to "Rearrange on one best tree". The germline sequence of the clone is used
for the outgroup.
Following tree construction using dnapars, the dnapars output is modified to allow
input sequences to appear as internal nodes of the tree. Intermediate sequences
inferred by dnapars are replaced by children within the tree having a Hamming distance
of zero from their parent node. With the default dist_mat, the distance calculation
allows IUPAC ambiguous character matches, where an ambiguous character has distance zero
to any character in the set of characters it represents. Distance calculation and movement of
child nodes up the tree is repeated until all parent-child pairs have a distance greater than zero
between them. The germline sequence (outgroup) is moved to the root of the tree and
excluded from the node replacement processes, which permits the trunk of the tree to be
the only edge with a distance of zero. Edge weights of the resultant tree are assigned
as the distance between each sequence.
Value
An igraph graph object defining the Ig lineage tree. Each unique input
sequence in clone is a vertex of the tree, with additional vertices being
either the germline (root) sequences or inferred intermediates. The graph
object has the following attributes.
Vertex attributes:
-
name: value in thesequence_idcolumn of thedataslot of the inputclonefor observed sequences. The germline (root) vertex is assigned the name "Germline" and inferred intermediates are assigned names with the format {"Inferred1", "Inferred2", ...}. -
sequence: value in thesequencecolumn of thedataslot of the inputclonefor observed sequences. The germline (root) vertex is assigned the sequence in thegermlineslot of the inputclone. The sequence of inferred intermediates are extracted from the dnapars output. -
label: same as thenameattribute.
Additionally, each other column in the data slot of the input
clone is added as a vertex attribute with the attribute name set to
the source column name. For the germline and inferred intermediate vertices,
these additional vertex attributes are all assigned a value of NA.
Edge attributes:
-
weight: Hamming distance between thesequenceattributes of the two vertices. -
label: same as theweightattribute.
Graph attributes:
-
clone: clone identifier from thecloneslot of the inputChangeoClone. -
v_gene: V-segment gene call from thev_geneslot of the inputChangeoClone. -
j_gene: J-segment gene call from thej_geneslot of the inputChangeoClone. -
junc_len: junction length (nucleotide count) from thejunc_lenslot of the inputChangeoClone.Alternatively, this function will return an
phyloobject, which is compatible with the ape package. This object will contain reconstructed ancestral sequences innodesattribute.
References
Felsenstein J. PHYLIP - Phylogeny Inference Package (Version 3.2). Cladistics. 1989 5:164-166.
Stern JNH, Yaari G, Vander Heiden JA, et al. B cells populating the multiple sclerosis brain mature in the draining cervical lymph nodes. Sci Transl Med. 2014 6(248):248ra107.
See Also
Takes as input a ChangeoClone.
Temporary directories are created with makeTempDir.
Distance is calculated using seqDist.
See [igraph](https://www.rdocumentation.org/packages/igraph/topics/aaa-igraph-package)
and [igraph.plotting](https://www.rdocumentation.org/packages/igraph/topics/plot.common)
for working with igraph graph objects.
Examples
## Not run:
# Preprocess clone
db <- subset(ExampleDb, clone_id == 3138)
clone <- makeChangeoClone(db, text_fields=c("sample_id", "c_call"),
num_fields="duplicate_count")
# Run PHYLIP and process output
phylip_exec <- "~/apps/phylip-3.695/bin/dnapars"
graph <- buildPhylipLineage(clone, phylip_exec, rm_temp=TRUE)
# Plot graph with a tree layout
library(igraph)
plot(graph, layout=layout_as_tree, vertex.label=V(graph)$c_call,
vertex.size=50, edge.arrow.mode=0, vertex.color="grey80")
# To consider each indel event as a mutation, change the masking character
# and distance matrix
clone <- makeChangeoClone(db, text_fields=c("sample_id", "c_call"),
num_fields="duplicate_count", mask_char="-")
graph <- buildPhylipLineage(clone, phylip_exec, dist_mat=getDNAMatrix(gap=-1),
rm_temp=TRUE)
## End(Not run)
Calculates the average bulkiness of amino acid sequences
Description
bulk calculates the average bulkiness score of amino acid sequences.
Non-informative positions are excluded, where non-informative is defined as any
character in c("X", "-", ".", "*").
Usage
bulk(seq, bulkiness = NULL)
Arguments
seq |
vector of strings containing amino acid sequences. |
bulkiness |
named numerical vector defining bulkiness scores for
each amino acid, where names are single-letter amino acid
character codes. If |
Value
A vector of bulkiness scores for the sequence(s).
References
Zimmerman JM, Eliezer N, Simha R. The characterization of amino acid sequences in proteins by statistical methods. J Theor Biol 21, 170-201 (1968).
See Also
For additional size related indices see aaindex.
Examples
# Default bulkiness scale
seq <- c("CARDRSTPWRRGIASTTVRTSW", "XXTQMYVRT")
bulk(seq)
# Use the Grantham, 1974 side chain volumn scores from the seqinr package
library(seqinr)
data(aaindex)
x <- aaindex[["GRAR740103"]]$I
# Rename the score vector to use single-letter codes
names(x) <- translateStrings(names(x), ABBREV_AA)
# Calculate average volume
bulk(seq, bulkiness=x)
Calculate sample coverage
Description
calcCoverage calculates the sample coverage estimate, a measure of sample
completeness, for varying orders using the method of Chao et al, 2015, falling back
to the Chao1 method in the first order case.
Usage
calcCoverage(x, r = 1)
Arguments
x |
numeric vector of abundance counts. |
r |
coverage order to calculate. |
Value
The sample coverage of the given order r.
References
Chao A. Nonparametric Estimation of the Number of Classes in a Population. Scand J Stat. 1984 11, 265270.
Chao A, et al. Unveiling the species-rank abundance distribution by generalizing the Good-Turing sample coverage theory. Ecology. 2015 96, 11891201.
See Also
Used by alphaDiversity.
Examples
# Calculate clone sizes
clones <- countClones(ExampleDb, groups="sample_id")
# Calculate 1first order coverage for a single sample
calcCoverage(clones$seq_count[clones$sample_id == "+7d"])
Calculate the diversity index
Description
calcDiversity calculates the clonal diversity index for a vector of diversity
orders.
Usage
calcDiversity(p, q)
Arguments
p |
numeric vector of clone (species) counts or proportions. |
q |
numeric vector of diversity orders. |
Details
This method, proposed by Hill (Hill, 1973), quantifies diversity as a smooth function
(D) of a single parameter q. Special cases of the generalized diversity
index correspond to the most popular diversity measures in ecology: species richness
(q = 0), the exponential of the Shannon-Weiner index (q approaches 1), the
inverse of the Simpson index (q = 2), and the reciprocal abundance of the largest
clone (q approaches +\infty). At q = 0 different clones weight equally,
regardless of their size. As the parameter q increase from 0 to +\infty
the diversity index (D) depends less on rare clones and more on common (abundant)
ones, thus encompassing a range of definitions that can be visualized as a single curve.
Values of q < 0 are valid, but are generally not meaningful. The value of D
at q=1 is estimated by D at q=0.9999.
Value
A vector of diversity scores D for each q.
References
Hill M. Diversity and evenness: a unifying notation and its consequences. Ecology. 1973 54(2):427-32.
See Also
Used by alphaDiversity.
Examples
# May define p as clonal member counts
p <- c(1, 1, 3, 10)
q <- c(0, 1, 2)
calcDiversity(p, q)
# Or proportional abundance
p <- c(1/15, 1/15, 1/5, 2/3)
calcDiversity(p, q)
Calculates the net charge of amino acid sequences.
Description
charge calculates the net charge of amino acid sequences using
the method of Moore, 1985, with exclusion of the C-terminus and N-terminus charges.
Usage
charge(seq, pH = 7.4, pK = NULL, normalize = FALSE)
Arguments
seq |
vector strings defining of amino acid sequences. |
pH |
environmental pH. |
pK |
named vector defining pK values for each charged amino acid,
where names are the single-letter amino acid character codes
|
normalize |
if |
Value
A vector of net charges for the sequence(s).
References
Moore DS. Amino acid and peptide net charges: A simple calculational procedure. Biochem Educ. 13, 10-11 (1985).
-
https://emboss.sourceforge.net/apps/cvs/emboss/apps/iep.html
See Also
For additional pK scales see pK.
Examples
seq <- c("CARDRSTPWRRGIASTTVRTSW", "XXTQMYVRT")
# Unnormalized charge
charge(seq)
# Normalized charge
charge(seq, normalize=TRUE)
# Use the Murray et al, 2006 scores from the seqinr package
library(seqinr)
data(pK)
x <- setNames(pK[["Murray"]], rownames(pK))
# Calculate charge
charge(seq, pK=x)
Check data.frame for valid columns and issue message if invalid
Description
Check data.frame for valid columns and issue message if invalid
Usage
checkColumns(data, columns, logic = c("all", "any"))
Arguments
data |
data.frame to check. |
columns |
vector of column names to check. |
logic |
one of |
Value
TRUE if columns are valid and a string message if not.
Examples
df <- data.frame(A=1:3, B=4:6, C=rep(NA, 3))
checkColumns(df, c("A", "B"), logic="all")
checkColumns(df, c("A", "B"), logic="any")
checkColumns(df, c("A", "C"), logic="all")
checkColumns(df, c("A", "C"), logic="any")
checkColumns(df, c("A", "D"), logic="all")
checkColumns(df, c("A", "D"), logic="any")
Remove duplicate DNA sequences and combine annotations
Description
collapseDuplicates identifies duplicate DNA sequences, allowing for ambiguous
characters, removes the duplicate entries, and combines any associated annotations.
Usage
collapseDuplicates(
data,
id = "sequence_id",
seq = "sequence_alignment",
text_fields = NULL,
num_fields = NULL,
seq_fields = NULL,
add_count = FALSE,
fields = NULL,
ignore = c("N", "-", ".", "?"),
sep = ",",
dry = FALSE,
verbose = FALSE
)
Arguments
data |
data.frame containing Change-O columns. The data.frame must contain, at a minimum, a unique identifier column and a column containing a character vector of DNA sequences. |
id |
name of the column containing sequence identifiers. |
seq |
name of the column containing DNA sequences. |
text_fields |
character vector of textual columns to collapse. The textual
annotations of duplicate sequences will be merged into a single
string with each unique value alphabetized and delimited by
|
num_fields |
vector of numeric columns to collapse. The numeric annotations of duplicate sequences will be summed. |
seq_fields |
vector of nucleotide sequence columns to collapse. The sequence
with the fewest number of non-informative characters will be
retained. Where a non-informative character is one of
|
add_count |
if |
fields |
character vector of additional column names used to group
sequences prior to identifying duplicates. If specified,
sequences will only be collapsed together if they are
equivalent in the |
ignore |
vector of characters to ignore when testing for equality. |
sep |
character to use for delimiting collapsed annotations in the
|
dry |
if |
verbose |
if |
Details
collapseDuplicates identifies duplicate sequences in the seq column by
testing for character identity, with consideration of IUPAC ambiguous nucleotide codes.
A cluster of sequences are considered duplicates if they are all equivalent, and no
member of the cluster is equivalent to a sequence in a different cluster.
Textual annotations, specified by text_fields, are collapsed by taking the unique
set of values within in each duplicate cluster and delimiting those values by sep.
Numeric annotations, specified by num_fields, are collapsed by summing all values
in the duplicate cluster. Sequence annotations, specified by seq_fields, are
collapsed by retaining the first sequence with the fewest number of N characters.
Columns that are not specified in either text_fields, num_fields, or
seq_fields will be retained, but the value will be chosen from a random entry
amongst all sequences in a cluster of duplicates.
If fields is specified, sequences are first grouped by the unique combinations
of values in the fields columns, and duplicates are then identified separately
within each group. As a result, sequences that are otherwise identical, but differ in
one or more fields columns (for example, distinct sample_id or c_call isotype
assignments), are kept as separate entries rather than being collapsed together.
Sequences with an NA value in a fields column are grouped together.
When fields is specified, the returned entries are ordered as they appeared
in the input, and, if dry=TRUE, the collapse_id values are unique
across groups and returned as character values.
An ambiguous sequence is one that can be assigned to two different clusters, wherein
the ambiguous sequence is equivalent to two sequences which are themselves
non-equivalent. Ambiguous sequences arise due to ambiguous characters at positions that
vary across sequences, and are discarded along with their annotations when dry=FALSE.
Thus, ambiguous sequences are removed as duplicates of some sequence, but do not create a potential
false-positive annotation merger. Ambiguous sequences are not included in the
collapse_count annotation that is added when add_count=TRUE.
If dry=TRUE sequences will not be removed from the input. Instead, the following columns
will be appended to the input defining the collapse action that would have been performed in the
dry=FALSE case.
-
collapse_id: an identifier for the group of identical sequences. A sequence withcollapse_class="ambiguous"belongs to more than one group and receives multiple identifiers delimited by",". -
collapse_class: string defining how the sequence matches to the other in the set. one of"duplicated"(has duplicates),"unique"(no duplicates),"ambiguous_duplicate"(no duplicates after ambiguous sequences are removed), or"ambiguous"(matches multiple non-duplicate sequences). -
collapse_pass:TRUEfor the sequences that would be retained. -
collapse_count: present only whenadd_count=TRUE. Because no sequences are collapsed during a dry run, this is1for every row and does not report sizes of the groups of identical sequences.
Value
A modified data data.frame with duplicate sequences removed and
annotation fields collapsed if dry=FALSE. If dry=TRUE,
sequences will be labeled with the collapse action, but the input will be
otherwise unmodified (see Details).
See Also
Equality is tested with seqEqual and pairwiseEqual. For IUPAC ambiguous character codes see IUPAC_DNA.
Examples
# Example data.frame
db <- data.frame(sequence_id=LETTERS[1:4],
sequence_alignment=c("CCCCTGGG", "CCCCTGGN", "NAACTGGN", "NNNCTGNN"),
c_call=c("IGHM", "IGHG", "IGHG", "IGHA"),
sample_id=c("S1", "S1", "S2", "S2"),
duplicate_count=1:4,
stringsAsFactors=FALSE)
# Annotations are not parsed if neither text_fields nor num_fields is specified
# The retained sequence annotations will be random
collapseDuplicates(db, verbose=TRUE)
# Unique text_fields annotations are combined into a single string with ","
# num_fields annotations are summed
# Ambiguous duplicates are discarded
collapseDuplicates(db, text_fields=c("c_call", "sample_id"), num_fields="duplicate_count",
verbose=TRUE)
# Use alternate delimiter for collapsing textual annotations
collapseDuplicates(db, text_fields=c("c_call", "sample_id"), num_fields="duplicate_count",
sep="/", verbose=TRUE)
# Add count of duplicates
collapseDuplicates(db, text_fields=c("c_call", "sample_id"), num_fields="duplicate_count",
add_count=TRUE, verbose=TRUE)
# Use fields to prevent collapsing sequences that differ in sample_id or c_call
collapseDuplicates(db, num_fields="duplicate_count",
fields=c("sample_id", "c_call"), add_count=TRUE, verbose=TRUE)
# Masking ragged ends may impact duplicate removal
db$sequence_alignment <- maskSeqEnds(db$sequence_alignment)
collapseDuplicates(db, text_fields=c("c_call", "sample_id"), num_fields="duplicate_count",
add_count=TRUE, verbose=TRUE)
Combine IgPhyML object parameters into a dataframe
Description
combineIgphyml combines IgPhyML object parameters into a data.frame.
Usage
combineIgphyml(iglist, format = c("wide", "long"))
Arguments
iglist |
list of igphyml objects returned by readIgphyml.
Each must have an |
format |
string specifying whether each column of the resulting data.frame
should represent a parameter ( |
Details
combineIgphyml combines repertoire-wide parameter estimates from multiple igphyml
objects produced by readIgphyml into a dataframe that can be easily used for plotting and
other hypothesis testing analyses.
All igphyml objects used must have an "id" column in their param attribute, which
can be added automatically from the id flag of readIgphyml.
Value
A data.frame containing HLP model parameter estimates for all igphyml objects. Only parameters shared among all objects will be returned.
References
Hoehn KB, Lunter G, Pybus OG - A Phylogenetic Codon Substitution Model for Antibody Lineages. Genetics 2017 206(1):417-427 https://doi.org/10.1534/genetics.116.196303
Hoehn KB, Vander Heiden JA, Zhou JQ, Lunter G, Pybus OG, Kleinstein SHK - Repertoire-wide phylogenetic models of B cell molecular evolution reveal evolutionary signatures of aging and vaccination. bioRxiv 2019 https://doi.org/10.1101/558825
See Also
Examples
## Not run:
# Read in and combine two igphyml runs
s1 <- readIgphyml("IB+7d_lineages_gy.tsv_igphyml_stats_hlp.tab", id="+7d")
s2 <- readIgphyml("IB+7d_lineages_gy.tsv_igphyml_stats_hlp.tab", id="s2")
combineIgphyml(list(s1, s2))
## End(Not run)
Tabulates clones sizes
Description
countClones determines the number of sequences and total copy number of
clonal groups.
Usage
countClones(
data,
groups = NULL,
copy = NULL,
clone = "clone_id",
cell_id = "cell_id",
remove_na = TRUE
)
Arguments
data |
data.frame with columns containing clonal assignments. |
groups |
character vector defining |
copy |
name of the |
clone |
name of the |
cell_id |
name of the |
remove_na |
removes rows with |
Value
A data.frame summarizing clone counts and frequencies with columns:
-
clone_id: clone identifier. This is the default column name, specified withclone='clone_id'. If the function call uses Change-O formatted data andclone='CLONE', this column will have nameCLONE. -
seq_count: total number of sequences for the clone. -
seq_freq: frequency of the clone as a fraction of the total number of sequences within each group. -
copy_count: sum of the copy counts in thecopycolumn. Only present if thecopyargument is specified. -
copy_freq: frequency of the clone as a fraction of the total copy number within each group. Only present if thecopyargument is specified.
Also includes additional columns specified in the groups argument.
Examples
# Without copy numbers
clones <- countClones(ExampleDb, groups="sample_id")
# With copy numbers and multiple groups
clones <- countClones(ExampleDb, groups=c("sample_id", "c_call"), copy="duplicate_count")
Tabulates V(D)J allele, gene or family usage within each locus.
Description
Determines the count and relative abundance of V(D)J alleles, genes or families within groups. If sequences from multiple loci are present, the frequency is calculated within each locus.
Usage
countGenes(
data,
gene,
groups = NULL,
copy = NULL,
clone = NULL,
fill = FALSE,
first = TRUE,
collapse = TRUE,
mode = c("gene", "allele", "family", "asis"),
cell_id = "cell_id",
remove_na = TRUE
)
Arguments
data |
data.frame with AIRR-format or Change-O style columns. |
gene |
column containing allele assignments. Only the first allele in the
column will be considered when |
groups |
columns containing grouping variables. If |
copy |
name of the |
clone |
name of the |
fill |
logical of |
first |
if TRUE return only the first allele/gene/family call for computing the frequency; if FALSE return all calls delimited by commas. |
collapse |
if TRUE check for duplicates and return only unique allele/gene/family assignments per sequence; if FALSE return all assignments (faster). Has no effect if first=TRUE. |
mode |
one of |
cell_id |
name of the |
remove_na |
removes rows with |
Value
A data.frame summarizing family, gene or allele counts and frequencies with columns:
-
locus: locus of the gene (IGH, IGK, IGL, TRA, TRB, TRD, TRG). Note that frequencies are calculated within each locus. -
gene: name of the family, gene or allele. -
seq_count: total number of sequences for the gene in the locus. -
locus_count: total number of sequences in the locus. -
seq_freq: frequency of the gene as a fraction of the total number of sequences within each grouping. -
copy_count: sum of the copy counts in thecopycolumn. for each gene. Only present if thecopyargument is specified. -
locus_copy_count: sum of the copy counts in thecopycolumn. for all gene in the locus. Only present if thecopyargument is specified. -
copy_freq: frequency of the gene as a fraction of the total copy number within each group. Only present if thecopyargument is specified. -
clone_count: total number of clones for the gene. Only present if thecloneargument is specified. -
clone_freq: frequency of the gene as a fraction of the total number of clones within each grouping. Only present if thecloneargument is specified.
Additional columns defined by the groups argument will also be present.
Examples
# Without copy numbers
genes <- countGenes(ExampleDb, gene = "v_call", groups = "sample_id", mode = "family")
genes <- countGenes(ExampleDb, gene = "v_call", groups = "sample_id", mode = "gene")
genes <- countGenes(ExampleDb, gene = "v_call", groups = "sample_id", mode = "allele")
# With copy numbers and multiple groups
genes <- countGenes(ExampleDb,
gene = "v_call", groups = c("sample_id", "c_call"),
copy = "duplicate_count", mode = "family"
)
# Count by clone
genes <- countGenes(ExampleDb,
gene = "v_call", groups = c("sample_id", "c_call"),
clone = "clone_id", mode = "family"
)
# Count absent genes
genes <- countGenes(ExampleDb,
gene = "v_call", groups = "sample_id",
mode = "allele", fill = TRUE
)
Count sequence patterns
Description
countPatterns counts the fraction of times a set of character patterns occur
in a set of sequences.
Usage
countPatterns(seq, patterns, nt = TRUE, trim = FALSE, label = "region")
Arguments
seq |
character vector of either DNA or amino acid sequences. |
patterns |
list of sequence patterns to count in each sequence. If the list is named, then names will be assigned as the column names of output data.frame. |
nt |
if |
trim |
if |
label |
string defining a label to add as a prefix to the output column names. |
Value
A data.frame containing the fraction of times each sequence pattern was found.
Examples
seq <- c("TGTCAACAGGCTAACAGTTTCCGGACGTTC",
"TGTCAGCAATATTATATTGCTCCCTTCACTTTC",
"TGTCAAAAGTATAACAGTGCCCCCTGGACGTTC")
patterns <- c("A", "V", "[LI]")
names(patterns) <- c("arg", "val", "iso_leu")
countPatterns(seq, patterns, nt=TRUE, trim=TRUE, label="cdr3")
Available CPU cores
Description
cpuCount determines the number of CPU cores available.
Usage
cpuCount()
Value
Count of available cores. Returns 1 if undeterminable.
Examples
cpuCount()
Estimates the complete clonal relative abundance distribution
Description
estimateAbundance estimates the complete clonal relative abundance distribution
and confidence intervals on clone sizes using bootstrapping.
Usage
estimateAbundance(
data,
clone = "clone_id",
copy = NULL,
group = NULL,
min_n = 30,
max_n = NULL,
uniform = TRUE,
ci = 0.95,
nboot = 200,
cell_id = "cell_id",
progress = FALSE
)
Arguments
data |
data.frame with Change-O style columns containing clonal assignments. |
clone |
name of the |
copy |
name of the |
group |
name of the |
min_n |
minimum number of observations to sample. A group with less observations than the minimum is excluded. |
max_n |
maximum number of observations to sample. If |
uniform |
if |
ci |
confidence interval to calculate; the value must be between 0 and 1. |
nboot |
number of bootstrap realizations to generate. |
cell_id |
name of the |
progress |
if |
Value
A AbundanceCurve object summarizing the abundances.
References
Chao A. Nonparametric Estimation of the Number of Classes in a Population. Scand J Stat. 1984 11, 265270.
Chao A, et al. Rarefaction and extrapolation with Hill numbers: A framework for sampling and estimation in species diversity studies. Ecol Monogr. 2014 84:45-67.
Chao A, et al. Unveiling the species-rank abundance distribution by generalizing the Good-Turing sample coverage theory. Ecology. 2015 96, 11891201.
See Also
See plotAbundanceCurve for plotting of the abundance distribution. See alphaDiversity for a similar application to clonal diversity.
Examples
abund <- estimateAbundance(ExampleDb, group="sample_id", nboot=100)
Extracts FWRs and CDRs from IMGT-gapped sequences
Description
extractVRegion extracts the framework and complementarity determining regions of
the V segment for IMGT-gapped immunoglobulin (Ig) nucleotide sequences according to the
IMGT numbering scheme.
Usage
extractVRegion(sequences, region = c("fwr1", "cdr1", "fwr2", "cdr2", "fwr3"))
Arguments
sequences |
character vector of IMGT-gapped nucleotide sequences. |
region |
string defining the region(s) of the V segment to extract.
May be a single region or multiple regions (as a vector) from
|
Value
If only one region is specified in the region argument, a character
vector of the extracted sub-sequences will be returned. If multiple regions
are specified, then a character matrix will be returned with columns
corresponding to the specified regions and a row for each entry in
sequences.
References
Lefranc M-P, et al. IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains. Dev Comp Immunol. 2003 27(1):55-77.
See Also
IMGT-gapped region boundaries are defined in IMGT_REGIONS.
Examples
# Assign example clone
clone <- subset(ExampleDb, clone_id == 3138)
# Get all regions
extractVRegion(clone$sequence_alignment)
# Get single region
extractVRegion(clone$sequence_alignment, "fwr1")
# Get all CDRs
extractVRegion(clone$sequence_alignment, c("cdr1", "cdr2"))
# Get all FWRs
extractVRegion(clone$sequence_alignment, c("fwr1", "fwr2", "fwr3"))
Faster calculation of pairwise distances between sequences of the same length and contain only "ACTGN?"
Description
fastDist calculates all pairwise distance between a set of sequences of the same length and contain only "ACTGN?".
Input is case-insensitive; lowercase characters are converted to uppercase before comparison.
Usage
fastDist(seqs)
Arguments
seqs |
character vector containing a DNA sequences. |
Value
Packed lower triangular matrix of distance between each entry in seq.
If seq is a named vector, row and columns names will be added
accordingly.
Examples
fastDist(c(A="ATGGC", B="ATGGG", C="ATGGG", D="AT?NC", E="NTGG?"))
Faster calculation of pairwise distances between amino acid sequences of the same length
Description
fastDistAA calculates all pairwise distances among a set of amino acid sequences of the same length.
Amino acid sequences may contain the 20 standard amino acid characters and four special characters: (X, ., -, *).
The characters X, -, and . match any character, whereas standard amino acids and stop codon * match only themselves.
Usage
fastDistAA(seqs)
Arguments
seqs |
character vector containing an amino acid sequences. |
Value
Packed lower triangular matrix of distance between each entry in seq.
If seq is a named vector, row and columns names will be added
accordingly.
Examples
fastDistAA(c(A="AEHGC*X", B="AEHGGIC", C="AXGGGIC", D="ATTNC-E", E="N.TGG**"))
Build an AA distance matrix
Description
getAAMatrix returns a Hamming distance matrix for IUPAC ambiguous
amino acid characters.
Usage
getAAMatrix(gap = 0)
Arguments
gap |
value to assign to characters in the set |
Value
A matrix of amino acid character distances with row and column names
indicating the character pair.
See Also
Creates an amino acid distance matrix for seqDist. See getDNAMatrix for nucleotide distances.
Examples
getAAMatrix()
Build a DNA distance matrix
Description
getDNAMatrix returns a Hamming distance matrix for IUPAC ambiguous
DNA characters with modifications for gap, c("-", "."), and missing,
c("?"), character values.
Usage
getDNAMatrix(gap = -1)
Arguments
gap |
value to assign to characters in the set |
Value
A matrix of DNA character distances with row and column names
indicating the character pair. By default, distances will be either 0
(equivalent), 1 (non-equivalent or missing), or -1 (gap).
See Also
Creates DNA distance matrix for seqDist. See getAAMatrix for amino acid distances.
Examples
# Set gap characters to Inf distance
# Distinguishes gaps from Ns
getDNAMatrix()
# Set gap characters to 0 distance
# Makes gap characters equivalent to Ns
getDNAMatrix(gap=0)
Retrieve the first non-root node of a lineage tree
Description
getMRCA returns the set of lineage tree nodes with the minimum weighted or
unweighted path length from the root (germline) of the lineage tree, allowing for
exclusion of specific groups of nodes.
Usage
getMRCA(
graph,
path = c("distance", "steps"),
root = "Germline",
field = NULL,
exclude = NULL
)
Arguments
graph |
igraph object containing an annotated lineage tree. |
path |
string defining whether to use unweighted (steps) or weighted (distance) measures for determining the founder node set.. |
root |
name of the root (germline) node. |
field |
annotation field to use for both unweighted path length exclusion and
consideration as an MRCA node. If |
exclude |
vector of annotation values in |
Value
A data.frame of the MRCA node(s) containing the columns:
-
name: node name -
steps: path length as the number of nodes traversed -
distance: path length as the sum of edge weights
Along with additional columns corresponding to the annotations of the input graph.
See Also
Path lengths are determined with getPathLengths.
Examples
# Define example graph
graph <- ExampleTrees[[23]]
# Use unweighted path length and do not exclude any nodes
getMRCA(graph, path="steps", root="Germline")
# Exclude nodes without an isotype annotation and use weighted path length
getMRCA(graph, path="distance", root="Germline", field="c_call", exclude=NA)
Calculate path lengths from the tree root
Description
getPathLengths calculates the unweighted (number of steps) and weighted (distance)
path lengths from the root of a lineage tree.
Usage
getPathLengths(graph, root = "Germline", field = NULL, exclude = NULL)
Arguments
graph |
igraph object containing an annotated lineage tree. |
root |
name of the root (germline) node. |
field |
annotation field to use for exclusion of nodes from step count. |
exclude |
annotation values specifying which nodes to exclude from step count.
If |
Value
A data.frame with columns:
-
name: node name -
steps: path length as the number of nodes traversed -
distance: path length as the sum of edge weights
See Also
See buildPhylipLineage for generating input trees.
Examples
# Define example graph
graph <- ExampleTrees[[24]]
# Consider all nodes
getPathLengths(graph, root="Germline")
# Exclude nodes without an isotype annotation from step count
getPathLengths(graph, root="Germline", field="c_call", exclude=NA)
Get a data.frame with sequencing qualities per position
Description
getPositionQuality takes a data.frame with sequence quality scores
in the form of a strings of comma separated numeric values, split the quality
scores values by ",", and returns a data.frame with the values
for each position.
Usage
getPositionQuality(
data,
sequence_id = "sequence_id",
sequence = "sequence_alignment",
quality_num = "quality_alignment_num"
)
Arguments
data |
|
sequence_id |
column in |
sequence |
column in |
quality_num |
column in |
Value
data with one additional field with masked sequences. The
name of this field is created concatenating sequence
and '_masked'.
See Also
readFastqDb and maskPositionsByQuality
Examples
db <- airr::read_rearrangement(system.file("extdata", "example_quality.tsv", package="alakazam"))
fastq_file <- system.file("extdata", "example_quality.fastq", package="alakazam")
db <- readFastqDb(db, fastq_file, quality_offset=-33)
head(getPositionQuality(db))
Get Ig segment allele, gene and family names
Description
getSegment performs generic matching of delimited segment calls with a custom
regular expression. getAllele, getGene and getFamily extract
the allele, gene and family names, respectively, from a character vector of
immunoglobulin (Ig) or TCR segment allele calls in IMGT format.
Usage
getSegment(
segment_call,
segment_regex,
first = TRUE,
collapse = TRUE,
strip_d = TRUE,
omit_nl = FALSE,
sep = ","
)
getAllele(
segment_call,
first = TRUE,
collapse = TRUE,
strip_d = TRUE,
omit_nl = FALSE,
sep = ","
)
getGene(
segment_call,
first = TRUE,
collapse = TRUE,
strip_d = TRUE,
omit_nl = FALSE,
sep = ","
)
getFamily(
segment_call,
first = TRUE,
collapse = TRUE,
strip_d = TRUE,
omit_nl = FALSE,
sep = ","
)
getLocus(
segment_call,
first = TRUE,
collapse = TRUE,
strip_d = TRUE,
omit_nl = FALSE,
sep = ","
)
getChain(
segment_call,
first = TRUE,
collapse = TRUE,
strip_d = TRUE,
omit_nl = FALSE,
sep = ","
)
Arguments
segment_call |
character vector containing segment calls delimited by commas. |
segment_regex |
string defining the segment match regular expression. |
first |
if |
collapse |
if |
strip_d |
if |
omit_nl |
if |
sep |
character defining both the input and output segment call delimiter. |
Value
A character vector containing allele, gene or family names.
References
See Also
Examples
# Light chain examples
kappa_call <- c(
"Homsap IGKV1D-39*01 F,Homsap IGKV1-39*02 F,Homsap IGKV1-39*01",
"Homsap IGKJ5*01 F"
)
getAllele(kappa_call)
getAllele(kappa_call, first = FALSE)
getAllele(kappa_call, first = FALSE, strip_d = FALSE)
getGene(kappa_call)
getGene(kappa_call, first = FALSE)
getGene(kappa_call, first = FALSE, strip_d = FALSE)
getFamily(kappa_call)
getFamily(kappa_call, first = FALSE)
getFamily(kappa_call, first = FALSE, collapse = FALSE)
getFamily(kappa_call, first = FALSE, strip_d = FALSE)
getLocus(kappa_call)
getChain(kappa_call)
# Heavy chain examples
heavy_call <- c(
"Homsap IGHV1-69*01 F,Homsap IGHV1-69D*01 F",
"Homsap IGHD1-1*01 F",
"Homsap IGHJ1*01 F"
)
getAllele(heavy_call, first = FALSE)
getAllele(heavy_call, first = FALSE, strip_d = FALSE)
getGene(heavy_call, first = FALSE)
getGene(heavy_call, first = FALSE, strip_d = FALSE)
getFamily(heavy_call)
getLocus(heavy_call)
getChain(heavy_call)
# Filtering non-localized genes
nl_call <- c(
"IGHV3-NL1*01,IGHV3-30-3*01,IGHV3-30*01",
"Homosap IGHV3-30*01 F,Homsap IGHV3-NL1*01 F",
"IGHV1-NL1*01"
)
getAllele(nl_call, first = FALSE, omit_nl = TRUE)
getGene(nl_call, first = FALSE, omit_nl = TRUE)
getFamily(nl_call, first = FALSE, omit_nl = TRUE)
# Temporary designation examples
tmp_call <- c("IGHV9S3*01", "IGKV10S12*01")
getAllele(tmp_call)
getGene(tmp_call)
getFamily(tmp_call)
Convert a tree in igraph graph format to ape phylo format.
Description
graphToPhylo a tree in igraph graph format to ape phylo
format.
Usage
graphToPhylo(graph)
Arguments
graph |
An igraph |
Details
Convert from igraph graph object to ape phylo object. If graph object
was previously rooted with the germline as the direct ancestor, this will re-attach the
germline as a descendant node with a zero branch length to a new universal common ancestor (UCA)
node and store the germline node ID in the germid attribute and UCA node number in
the uca attribute. Otherwise these attributes will not be specified in the phylo object.
Using phyloToGraph(phylo, germline=phylo$germid) creates a graph object with the germline
back as the direct ancestor. Tip and internal node names are
stored in the tip.label and node.label vectors, respectively.
Value
A phylo object representing the input tree. Tip and internal node names are
stored in the tip.label and node.label vectors, respectively.
References
Hoehn KB, Lunter G, Pybus OG - A Phylogenetic Codon Substitution Model for Antibody Lineages. Genetics 2017 206(1):417-427 https://doi.org/10.1534/genetics.116.196303
Hoehn KB, Vander Heiden JA, Zhou JQ, Lunter G, Pybus OG, Kleinstein SHK - Repertoire-wide phylogenetic models of B cell molecular evolution reveal evolutionary signatures of aging and vaccination. bioRxiv 2019 https://doi.org/10.1101/558825
Examples
## Not run:
library(igraph)
library(ape)
#convert to phylo
phylo = graphToPhylo(graph)
#plot tree using ape
plot(phylo,show.node.label=TRUE)
#store as newick tree
write.tree(phylo,file="tree.newick")
#read in tree from newick file
phylo_r = read.tree("tree.newick")
#convert to igraph
graph_r = phyloToGraph(phylo_r,germline="Germline")
#plot graph - same as before, possibly rotated
plot(graph_r,layout=layout_as_tree)
## End(Not run)
Calculates the hydrophobicity of amino acid sequences
Description
gravy calculates the Grand Average of Hydrophobicity (gravy) index
of amino acid sequences using the method of Kyte & Doolittle. Non-informative
positions are excluded, where non-informative is defined as any character in
c("X", "-", ".", "*").
Usage
gravy(seq, hydropathy = NULL)
Arguments
seq |
vector of strings containing amino acid sequences. |
hydropathy |
named numerical vector defining hydropathy index values for
each amino acid, where names are single-letter amino acid
character codes. If |
Value
A vector of gravy scores for the sequence(s).
References
Kyte J, Doolittle RF. A simple method for displaying the hydropathic character of a protein. J Mol Biol. 157, 105-32 (1982).
See Also
For additional hydrophobicity indices see aaindex.
Examples
# Default scale
seq <- c("CARDRSTPWRRGIASTTVRTSW", "XXTQMYVRT")
gravy(seq)
# Use the Kidera et al, 1985 scores from the seqinr package
library(seqinr)
data(aaindex)
x <- aaindex[["KIDA850101"]]$I
# Rename the score vector to use single-letter codes
names(x) <- translateStrings(names(x), ABBREV_AA)
# Calculate hydrophobicity
gravy(seq, hydropathy=x)
Plot multiple ggplot objects
Description
Plots multiple ggplot objects in an equally sized grid.
Usage
gridPlot(..., ncol = 1)
Arguments
... |
ggplot objects to plot. |
ncol |
number of columns in the plot. |
References
Modified from: http://www.cookbook-r.com/Graphs/Multiple_graphs_on_one_page_(ggplot2)
See Also
Group sequences by gene assignment
Description
groupGenes will group rows by shared V and J gene assignments,
and optionally also by junction lengths. IGH:IGK/IGL, TRB:TRA, and TRD:TRG
paired single-cell BCR/TCR sequencing and unpaired bulk sequencing
(IGH, TRB, TRD chain only) are supported. In the case of ambiguous (multiple)
gene assignments, the grouping may be specified to be a union across all
ambiguous V and J gene pairs, analogous to single-linkage clustering
(i.e., allowing for chaining).
Usage
groupGenes(
data,
v_call = "v_call",
j_call = "j_call",
junc_len = NULL,
sequence_alignment = NULL,
cell_id = NULL,
split_light = FALSE,
locus = "locus",
only_heavy = TRUE,
first = FALSE
)
Arguments
data |
data.frame containing sequence data. |
v_call |
name of the column containing the heavy/long chain V-segment allele calls. |
j_call |
name of the column containing the heavy/long chain J-segment allele calls. |
junc_len |
name of column containing the junction length.
If |
sequence_alignment |
name of the column containing the sequence alignment. |
cell_id |
name of the column containing cell identifiers or barcodes.
If specified, grouping will be performed in single-cell mode
with the behavior governed by the |
split_light |
A deprecated parameter. This would split clones by the light chain. For similar function use dowser::resolveLightChains |
locus |
name of the column containing locus information.
Only applicable to single-cell data.
Ignored if |
only_heavy |
This is deprecated. Only heavy chains will be used in clustering.
Use only the IGH (BCR) or TRB/TRD (TCR) sequences
for grouping. Only applicable to single-cell data.
Ignored if |
first |
if |
Details
To invoke single-cell mode the cell_id argument must be specified and the locus
column must be correct. Otherwise, groupGenes will be run with bulk sequencing assumptions,
using all input sequences regardless of the values in the locus column.
Values in the locus column must be one of c("IGH", "IGI", "IGK", "IGL") for BCR
or c("TRA", "TRB", "TRD", "TRG") for TCR sequences. Otherwise, the function returns an
error message and stops.
Under single-cell mode with paired chained sequences, there was a choice of whether
grouping should be done by (a) using IGH (BCR) or TRB/TRD (TCR) sequences only or
(b) using IGH plus IGK/IGL (BCR) or TRB/TRD plus TRA/TRG (TCR).
This was governed by the only_heavy argument, now deprecated.
Specifying junc_len will force groupGenes to perform a 1-stage partitioning of the
sequences/cells based on V gene, J gene, and junction length simultaneously.
If junc_len=NULL (no column specified), then groupGenes performs only the first
stage of a 2-stage partitioning in which sequences/cells are partitioned in the first stage
based on V gene and J gene, and then in the second stage further splits the groups based on
junction length (the second stage must be performed independently, as this only returns the
first stage results).
In the input data, the v_call, j_call, cell_id, and locus
columns, if present, must be of type character (as opposed to factor).
It is assumed that ambiguous gene assignments are separated by commas.
All rows containing NA values in any of the v_call, j_call, and junc_len
(if junc_len != NULL) columns will be removed. A warning will be issued when a row
containing an NA is removed.
Value
Returns a modified data.frame with disjoint union indices
in a new vj_group column.
If junc_len is supplied, the grouping this vj_group
will have been based on V, J, and junction length simultaneously. However,
the output column name will remain vj_group.
The output v_call, j_call, cell_id, and locus
columns will be converted to type character if they were of type
factor in the input data.
Expectations for single-cell data
Single-cell paired chain data assumptions:
every row represents a sequence (chain).
heavy/long and light/short chains of the same cell are linked by
cell_id.the value in
locuscolumn indicates whether the chain is the heavy/long or light/short chain.each cell possibly contains multiple heavy/long and/or light/short chains.
every chain has its own V(D)J annotation, in which ambiguous V(D)J annotations, if any, are separated by a comma.
Single-cell example:
A cell has 1 heavy chain and 2 light chains.
There should be 3 rows corresponding to this cell.
One of the light chains may have an ambiguous V annotation which looks like
"Homsap IGKV1-39*01 F,Homsap IGKV1D-39*01 F".
Examples
# Group by genes
db <- groupGenes(ExampleDb)
head(db$vj_group)
Validate amino acid sequences
Description
isValidAASeq checks that a set of sequences are valid non-ambiguous
amino acid sequences. A sequence is considered valid if it contains only
characters in the the non-ambiguous IUPAC character set or any characters in
c("X", ".", "-", "*").
Usage
isValidAASeq(seq)
Arguments
seq |
character vector of sequences to check. |
Value
A logical vector with TRUE for each valid amino acid sequences
and FALSE for each invalid sequence.
See Also
See ABBREV_AA for the set of non-ambiguous amino acid characters. See IUPAC_AA for the full set of ambiguous amino acid characters.
Examples
seq <- c("CARDRSTPWRRGIASTTVRTSW", "XXTQMYVR--XX", "CARJ", "10")
isValidAASeq(seq)
Calculate junction region alignment properties
Description
junctionAlignment determines the number of deleted germline nucleotides in the
junction region and the number of V gene and J gene nucleotides in the CDR3.
Usage
junctionAlignment(
data,
germline_db,
v_call = "v_call",
d_call = "d_call",
j_call = "j_call",
v_germline_start = "v_germline_start",
v_germline_end = "v_germline_end",
d_germline_start = "d_germline_start",
d_germline_end = "d_germline_end",
j_germline_start = "j_germline_start",
j_germline_end = "j_germline_end",
np1_length = "np1_length",
np2_length = "np2_length",
junction = "junction",
junction_length = "junction_length",
sequence_alignment = "sequence_alignment"
)
Arguments
data |
|
germline_db |
reference germline database for the V, D and J genes.
in |
v_call |
V gene assignment column. |
d_call |
D gene assignment column. |
j_call |
J gene assignment column. |
v_germline_start |
column containing the start position of the alignment in the V reference germline. |
v_germline_end |
column containing the end position of the alignment in the V reference germline. |
d_germline_start |
column containing the start position of the alignment in the D reference germline. |
d_germline_end |
column containing the start position of the alignment in the D reference germline. |
j_germline_start |
column containing the start position of the alignment in the J reference germline. |
j_germline_end |
column containing the start position of the alignment in the J reference germline. |
np1_length |
combined length of the N and P regions between the V and D regions (heavy chain) or V and J regions (light chain). |
np2_length |
combined length of the N and P regions between the D and J regions (heavy chain). |
junction |
column containing the junction sequence. |
junction_length |
column containing the length of the junction region in nucleotides. |
sequence_alignment |
column containing the aligned sequence. |
Value
A modified input data.frame with the following additional columns storing
junction alignment information:
-
e3v_length: number of 3' V germline nucleotides deleted. -
e5d_length: number of 5' D germline nucleotides deleted. -
e3d_length: number of 3' D germline nucleotides deleted. -
e5j_length: number of 5' J germline nucleotides deleted. -
v_cdr3_length: number of sequence_alignment V nucleotides in the CDR3. -
j_cdr3_length: number of sequence_alignment J nucleotides in the CDR3.
Examples
germline_db <- list(
"IGHV3-11*05"="CAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTCAAGCCTGGAGGGTCCCTGAGACT
CTCCTGTGCAGCCTCTGGATTCACCTTC............AGTGACTACTACATGAGCTGGATCCGCCAGGCTCCAG
GGAAGGGGCTGGAGTGGGTTTCATACATTAGTAGTAGT......AGTAGTTACACAAACTACGCAGACTCTGTGAAG
...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGA
CACGGCCGTGTATTACTGTGCGAGAGA",
"IGHD3-10*01"="GTATTACTATGGTTCGGGGAGTTATTATAAC",
"IGHJ5*02"="ACAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG"
)
db <- junctionAlignment(SingleDb, germline_db)
Generate a ChangeoClone object for lineage construction
Description
makeChangeoClone takes a data.frame with AIRR or Change-O style columns as input and
masks gap positions, masks ragged ends, removes duplicate sequences, and merges
annotations associated with duplicate sequences. It returns a ChangeoClone
object which serves as input for lineage reconstruction. Note: To use the
most recent methods for building, visualizing and analyzing
trees, use the R package [Dowser](https://dowser.readthedocs.io).
Usage
makeChangeoClone(
data,
id = "sequence_id",
seq = "sequence_alignment",
germ = "germline_alignment",
v_call = "v_call",
j_call = "j_call",
junc_len = "junction_length",
clone = "clone_id",
mask_char = "N",
locus = "locus",
max_mask = 0,
pad_end = FALSE,
text_fields = NULL,
num_fields = NULL,
seq_fields = NULL,
add_count = TRUE,
verbose = FALSE
)
Arguments
data |
data.frame containing the AIRR or Change-O data for a clone. See Details for the list of required columns and their default values. |
id |
name of the column containing sequence identifiers. |
seq |
name of the column containing observed DNA sequences. All sequences in this column must be multiple aligned. |
germ |
name of the column containing germline DNA sequences. All entries
in this column should be identical for any given clone, and they
must be multiple aligned with the data in the |
v_call |
name of the column containing V-segment allele assignments. All entries in this column should be identical to the gene level. |
j_call |
name of the column containing J-segment allele assignments. All entries in this column should be identical to the gene level. |
junc_len |
name of the column containing the length of the junction as a numeric value. All entries in this column should be identical for any given clone. |
clone |
name of the column containing the identifier for the clone. All entries in this column should be identical. |
mask_char |
character to use for masking and padding. |
locus |
name of the column containing locus specification. Must be present and only contain the value "IGH", representing heavy chains. |
max_mask |
maximum number of characters to mask at the leading and trailing
sequence ends. If |
pad_end |
if |
text_fields |
text annotation columns to retain and merge during duplicate removal. |
num_fields |
numeric annotation columns to retain and sum during duplicate removal. |
seq_fields |
sequence annotation columns to retain and collapse during duplicate
removal. Note, this is distinct from the |
add_count |
if |
verbose |
passed on to |
Details
The input data.frame (data) must columns for each of the required column name
arguments: id, seq, germ, v_call, j_call,
junc_len, and clone. The default values are as follows:
-
id = "sequence_id": unique sequence identifier. -
seq = "sequence_alignment": IMGT-gapped sample sequence. -
germ = "germline_alignment": IMGT-gapped germline sequence. -
v_call = "v_call": V segment allele call. -
j_call = "j_call": J segment allele call. -
junc_len = "junction_length": junction sequence length. -
clone = "clone_id": clone identifier.
Additional annotation columns specified in the text_fields, num_fields
or seq_fields arguments will be retained in the data slot of the return
object, but are not required. If the input data.frame data already contains a
column named sequence, which is not used as the seq argument, then that
column will not be retained.
The default columns are IMGT-gapped sequence columns, but this is not a requirement. However, all sequences (both observed and germline) must be multiple aligned using some scheme for both proper duplicate removal and lineage reconstruction.
The value for the germline sequence, V-segment gene call, J-segment gene call,
junction length, and clone identifier are determined from the first entry in the
germ, v_call, j_call, junc_len and clone columns,
respectively. For any given clone, each value in these columns should be identical.
Value
A ChangeoClone object containing the modified clone.
See Also
Executes in order maskSeqGaps, maskSeqEnds, padSeqEnds, and collapseDuplicates. Returns a ChangeoClone object which serves as input to buildPhylipLineage.
Examples
# Example data
db <- data.frame(sequence_id=LETTERS[1:4],
sequence_alignment=c("CCCCTGGG", "CCCCTGGN", "NAACTGGN", "NNNCTGNN"),
germline_alignment="CCCCAGGG",
v_call="Homsap IGKV1-39*01 F",
j_call="Homsap IGKJ5*01 F",
junction_length=2,
clone_id=1,
locus=rep("IGH", length=4),
c_call=c("IGHM", "IGHG", "IGHG", "IGHA"),
duplicate_count=1:4,
stringsAsFactors=FALSE)
# Without end masking
makeChangeoClone(db, text_fields="c_call", num_fields="duplicate_count")
# With end masking
makeChangeoClone(db, max_mask=3, text_fields="c_call", num_fields="duplicate_count")
Create a temporary folder
Description
makeTempDir creates a randomly named temporary folder in the
system temp location.
Usage
makeTempDir(prefix)
Arguments
prefix |
prefix name for the folder. |
Value
The path to the temporary folder.
See Also
This is just a wrapper for tempfile and dir.create.
Examples
## Not run:
makeTempDir("Clone50")
## End(Not run)
Mask sequence positions with low quality
Description
maskPositionsByQuality will replace positions that
have a sequencing quality score lower that min_quality with an
"N" character.
Usage
maskPositionsByQuality(
data,
min_quality = 70,
sequence = "sequence_alignment",
quality_num = "quality_alignment_num"
)
Arguments
data |
|
min_quality |
minimum quality score. Positions with sequencing quality
less than |
sequence |
column in |
quality_num |
column in |
Value
Modified data data.frame with an additional field containing
quality masked sequences. The name of this field is created
concatenating the sequence name and "_masked".
See Also
readFastqDb and getPositionQuality
Examples
db <- airr::read_rearrangement(system.file("extdata", "example_quality.tsv", package="alakazam"))
fastq_file <- system.file("extdata", "example_quality.fastq", package="alakazam")
db <- readFastqDb(db, fastq_file, quality_offset=-33)
maskPositionsByQuality(db, min_quality=90, quality_num="quality_alignment_num")
Masks ragged leading and trailing edges of aligned DNA sequences
Description
maskSeqEnds takes a vector of DNA sequences, as character strings,
and replaces the leading and trailing characters with "N" characters to create
a sequence vector with uniformly masked outer sequence segments.
Usage
maskSeqEnds(seq, mask_char = "N", max_mask = NULL, trim = FALSE)
Arguments
seq |
character vector of DNA sequence strings. |
mask_char |
character to use for masking. |
max_mask |
the maximum number of characters to mask. If set to 0 then
no masking will be performed. If set to |
trim |
if |
Value
A modified seq vector with masked (or optionally trimmed) sequences.
See Also
See maskSeqGaps for masking internal gaps. See padSeqEnds for padding sequence of unequal length.
Examples
# Default behavior uniformly masks ragged ends
seq <- c("CCCCTGGG", "NAACTGGN", "NNNCTGNN")
maskSeqEnds(seq)
# Does nothing
maskSeqEnds(seq, max_mask=0)
# Cut ragged sequence ends
maskSeqEnds(seq, trim=TRUE)
# Set max_mask to limit extent of masking and trimming
maskSeqEnds(seq, max_mask=1)
maskSeqEnds(seq, max_mask=1, trim=TRUE)
# Mask dashes instead of Ns
seq <- c("CCCCTGGG", "-AACTGG-", "---CTG--")
maskSeqEnds(seq, mask_char="-")
Masks gap characters in DNA sequences
Description
maskSeqGaps substitutes gap characters, c("-", "."), with "N"
in a vector of DNA sequences.
Usage
maskSeqGaps(seq, mask_char = "N", outer_only = FALSE)
Arguments
seq |
character vector of DNA sequence strings. |
mask_char |
character to use for masking. |
outer_only |
if |
Value
A modified seq vector with "N" in place of c("-", ".")
characters.
See Also
See maskSeqEnds for masking ragged edges.
Examples
# Mask with Ns
maskSeqGaps(c("ATG-C", "CC..C"))
maskSeqGaps("--ATG-C-")
maskSeqGaps("--ATG-C-", outer_only=TRUE)
# Mask with dashes
maskSeqGaps(c("ATG-C", "CC..C"), mask_char="-")
Calculate pairwise distances between sequences
Description
nonsquareDist calculates all pairwise distance between a set of sequences and a subset of it.
Usage
nonsquareDist(seq, indx, dist_mat = getDNAMatrix())
Arguments
seq |
vector containing a DNA sequences of IUPAC characters. The sequence vector needs to be named. |
indx |
numeric vector containing the indices (a subset of indices of |
dist_mat |
Character distance matrix. Defaults to a Hamming distance
matrix returned by getDNAMatrix. If gap
characters, |
Value
A matrix of numerical distance between each entry in seq and
sequences specified by indx indices.
Note that the input subsampled indices will be ordered ascendingly. Therefore,
it is necessary to assign unique names to the input sequences, seq,
to recover the input order later. Row and columns names will be added accordingly.
Amino acid distance matrix may be built with getAAMatrix. Uses seqDist for calculating distances between pairs. See pairwiseEqual for generating an equivalence matrix.
Examples
# Gaps will be treated as Ns with a gap=0 distance matrix
seq <- c(A="ATGGC", B="ATGGG", C="ATGGG", D="AT--C")
pairwiseDist(seq,
dist_mat=getDNAMatrix(gap=0))
nonsquareDist(seq, indx=c(1,3),
dist_mat=getDNAMatrix(gap=0))
Pads ragged ends of aligned DNA sequences
Description
padSeqEnds takes a vector of DNA sequences, as character strings,
and appends the ends of each sequence with an appropriate number of "N"
characters to create a sequence vector with uniform lengths.
Usage
padSeqEnds(seq, len = NULL, start = FALSE, pad_char = "N", mod3 = TRUE)
Arguments
seq |
character vector of DNA sequence strings. |
len |
length to pad to. Only applies if longer than the maximum length of
the data in |
start |
if |
pad_char |
character to use for padding. |
mod3 |
if |
Value
A modified seq vector with padded sequences.
See Also
See maskSeqEnds for creating uniform masking from existing masking.
Examples
# Default behavior uniformly pads ragged ends
seq <- c("CCCCTGGG", "ACCCTG", "CCCC")
padSeqEnds(seq)
# Pad to fixed length
padSeqEnds(seq, len=15)
# Add padding to the beginning of the sequences instead of the ends
padSeqEnds(seq, start=TRUE)
padSeqEnds(seq, len=15, start=TRUE)
Calculate pairwise distances between sequences
Description
pairwiseDist calculates all pairwise distance between a set of sequences.
Usage
pairwiseDist(seq, dist_mat = getDNAMatrix())
Arguments
seq |
character vector containing a DNA sequences. |
dist_mat |
Character distance matrix. Defaults to a Hamming distance
matrix returned by getDNAMatrix. If gap
characters, |
Value
A matrix of numerical distance between each entry in seq.
If seq is a named vector, row and columns names will be added
accordingly.
Amino acid distance matrix may be built with getAAMatrix. Uses seqDist for calculating distances between pairs. See pairwiseEqual for generating an equivalence matrix.
Examples
# Gaps will be treated as Ns with a gap=0 distance matrix
pairwiseDist(c(A="ATGGC", B="ATGGG", C="ATGGG", D="AT--C"),
dist_mat=getDNAMatrix(gap=0))
# Gaps will be treated as universally non-matching characters with gap=1
pairwiseDist(c(A="ATGGC", B="ATGGG", C="ATGGG", D="AT--C"),
dist_mat=getDNAMatrix(gap=1))
# Gaps of any length will be treated as single mismatches with a gap=-1 distance matrix
pairwiseDist(c(A="ATGGC", B="ATGGG", C="ATGGG", D="AT--C"),
dist_mat=getDNAMatrix(gap=-1))
Calculate pairwise equivalence between sequences
Description
pairwiseEqual determined pairwise equivalence between a pairs in a
set of sequences, excluding ambiguous positions (Ns and gaps).
Usage
pairwiseEqual(seq, ignore = as.character(c("N", "-", ".", "?")))
Arguments
seq |
character vector containing a DNA sequences. |
ignore |
vector of characters to ignore when testing for equality. Default is to ignore c("N","-",".","?") |
Value
A logical matrix of equivalence between each entry in seq.
Values are TRUE when sequences are equivalent and FALSE
when they are not.
See Also
Uses seqEqual for testing equivalence between pairs. See pairwiseDist for generating a sequence distance matrix.
Examples
# Gaps and Ns will match any character
seq <- c(A="ATGGC", B="ATGGG", C="ATGGG", D="AT--C", E="NTGGG")
d <- pairwiseEqual(seq)
rownames(d) <- colnames(d) <- seq
d
# Ignore only Ns, so that gaps are not treated as matching any character
d <- pairwiseEqual(seq, ignore="N")
rownames(d) <- colnames(d) <- seq
d
Permute the node labels of a tree
Description
permuteLabels permutes the node annotations of a lineage tree.
Usage
permuteLabels(graph, field, exclude = c("Germline", NA))
Arguments
graph |
igraph object containing an annotated lineage tree. |
field |
string defining the annotation field to permute. |
exclude |
vector of strings defining |
Value
A modified igraph object with vertex annotations permuted.
See Also
Examples
# Define and plot example graph
library(igraph)
graph <- ExampleTrees[[23]]
plot(graph, layout=layout_as_tree, vertex.label=V(graph)$c_call,
vertex.size=50, edge.arrow.mode=0, vertex.color="grey80")
# Permute annotations and plot new tree
set.seed(123)
g <- permuteLabels(graph, "c_call")
plot(g, layout=layout_as_tree, vertex.label=V(g)$c_call,
vertex.size=50, edge.arrow.mode=0, vertex.color="grey80")
Convert a tree in ape phylo format to igraph graph format.
Description
phyloToGraph converts a tree in phylo format to and
graph format.
Usage
phyloToGraph(phylo, germline = "Germline")
Arguments
phylo |
An ape |
germline |
If specified, places specified tip sequence as the direct ancestor of the tree |
Details
Convert from phylo to graph object. Uses the node.label vector to label internal nodes. Nodes may rotate but overall topology will remain constant.
Value
A graph object representing the input tree.
References
Hoehn KB, Lunter G, Pybus OG - A Phylogenetic Codon Substitution Model for Antibody Lineages. Genetics 2017 206(1):417-427 https://doi.org/10.1534/genetics.116.196303
Hoehn KB, Vander Heiden JA, Zhou JQ, Lunter G, Pybus OG, Kleinstein SHK - Repertoire-wide phylogenetic models of B cell molecular evolution reveal evolutionary signatures of aging and vaccination. bioRxiv 2019 https://doi.org/10.1101/558825
Examples
## Not run:
library(igraph)
library(ape)
#convert to phylo
phylo = graphToPhylo(graph)
#plot tree using ape
plot(phylo,show.node.label=TRUE)
#store as newick tree
write.tree(phylo,file="tree.newick")
#read in tree from newick file
phylo_r = read.tree("tree.newick")
#convert to igraph
graph_r = phyloToGraph(phylo_r,germline="Germline")
#plot graph - same as before, possibly rotated
plot(graph_r,layout=layout_as_tree)
## End(Not run)
Plot a clonal abundance distribution
Description
plotAbundanceCurve plots the results from estimating the complete clonal
relative abundance distribution. The distribution is plotted as a log rank abundance
distribution.
Usage
plotAbundanceCurve(
data,
colors = NULL,
main_title = "Rank Abundance",
legend_title = NULL,
xlim = NULL,
ylim = NULL,
annotate = c("none", "depth"),
silent = FALSE,
...
)
Arguments
data |
AbundanceCurve object returned by estimateAbundance. |
colors |
named character vector whose names are values in the
|
main_title |
string specifying the plot title. |
legend_title |
string specifying the legend title. |
xlim |
numeric vector of two values specifying the
|
ylim |
numeric vector of two values specifying the
|
annotate |
string defining whether to added values to the group labels
of the legend. When |
silent |
if |
... |
additional arguments to pass to ggplot2::theme. |
Value
A ggplot object defining the plot.
See Also
See AbundanceCurve for the input object and estimateAbundance for generating the input abundance distribution. Plotting is performed with ggplot.
Examples
# Estimate abundance by sample and plot
abund <- estimateAbundance(ExampleDb, group="sample_id", nboot=100)
plotAbundanceCurve(abund, legend_title="Sample")
Plot the results of alphaDiversity
Description
plotDiversityCurve plots a DiversityCurve object.
Usage
plotDiversityCurve(
data,
colors = NULL,
main_title = "Diversity",
legend_title = "Group",
log_x = FALSE,
log_y = FALSE,
xlim = NULL,
ylim = NULL,
annotate = c("none", "depth"),
score = c("diversity", "evenness"),
silent = FALSE,
...
)
Arguments
data |
DiversityCurve object returned by alphaDiversity. |
colors |
named character vector whose names are values in the
|
main_title |
string specifying the plot title. |
legend_title |
string specifying the legend title. |
log_x |
if |
log_y |
if |
xlim |
numeric vector of two values specifying the
|
ylim |
numeric vector of two values specifying the
|
annotate |
string defining whether to added values to the group labels
of the legend. When |
score |
one of |
silent |
if |
... |
additional arguments to pass to ggplot2::theme. |
Value
A ggplot object defining the plot.
See Also
See alphaDiversity and alphaDiversity for generating DiversityCurve objects for input. Plotting is performed with ggplot.
Examples
# Calculate diversity
div <- alphaDiversity(ExampleDb, group="sample_id", nboot=100)
# Plot diversity
plotDiversityCurve(div, legend_title="Sample")
# Plot diversity
plotDiversityCurve(div, legend_title="Sample", score="evenness")
Plot the results of diversity testing
Description
plotDiversityTest plots summary data for a DiversityCurve object
with mean and a line range indicating plus/minus one standard deviation.
Usage
plotDiversityTest(
data,
q,
colors = NULL,
main_title = "Diversity",
legend_title = "Group",
log_d = FALSE,
annotate = c("none", "depth"),
silent = FALSE,
...
)
Arguments
data |
DiversityCurve object returned by alphaDiversity. |
q |
diversity order to plot the test for. |
colors |
named character vector whose names are values in the
|
main_title |
string specifying the plot title. |
legend_title |
string specifying the legend title. |
log_d |
if |
annotate |
string defining whether to added values to the group labels
of the legend. When |
silent |
if |
... |
additional arguments to pass to ggplot2::theme. |
Value
A ggplot object defining the plot.
See Also
See alphaDiversity for generating input. Plotting is performed with ggplot.
Examples
# Calculate diversity
div <- alphaDiversity(ExampleDb, group="sample_id", min_q=0, max_q=2, step_q=1, nboot=100)
# Plot results at q=0 (equivalent to species richness)
plotDiversityTest(div, 0, legend_title="Sample")
# Plot results at q=2 (equivalent to Simpson's index)
plotDiversityTest(div, q=2, legend_title="Sample")
Plot the results of an edge permutation test
Description
plotEdgeTest plots the results of an edge permutation test performed with
testEdges as either a histogram or cumulative distribution function.
Usage
plotEdgeTest(
data,
color = "black",
main_title = "Edge Test",
style = c("histogram", "cdf"),
silent = FALSE,
...
)
Arguments
data |
|
color |
color of the histogram or lines. |
main_title |
string specifying the plot title. |
style |
type of plot to draw. One of:
|
silent |
if |
... |
additional arguments to pass to ggplot2::theme. |
Value
A ggplot object defining the plot.
See Also
See testEdges for performing the test.
Examples
# Define example tree set
graphs <- ExampleTrees[6:10]
# Perform edge test on isotypes
x <- testEdges(graphs, "c_call", nperm=6)
# Plot
plotEdgeTest(x, color="steelblue", style="hist")
plotEdgeTest(x, style="cdf")
Plot the results of a founder permutation test
Description
plotMRCATest plots the results of a founder permutation test performed with
testMRCA.
Usage
plotMRCATest(
data,
color = "black",
main_title = "MRCA Test",
style = c("histogram", "cdf"),
silent = FALSE,
...
)
Arguments
data |
|
color |
color of the histogram or lines. |
main_title |
string specifying the plot title. |
style |
type of plot to draw. One of:
|
silent |
if |
... |
additional arguments to pass to ggplot2::theme. |
Value
A ggplot object defining the plot.
See Also
See testEdges for performing the test.
Examples
# Define example tree set
graphs <- ExampleTrees[1:10]
# Perform MRCA test on isotypes
set.seed(123)
x <- testMRCA(graphs, "c_call", nperm=10)
# Plot
plotMRCATest(x, color="steelblue", style="hist")
plotMRCATest(x, style="cdf")
Plots subtree statistics for multiple trees
Description
plotSubtree plots distributions of normalized subtree statistics for a
set of lineage trees, broken down by annotation value.
Usage
plotSubtrees(
graphs,
field,
stat,
root = "Germline",
exclude = c("Germline", NA),
colors = NULL,
main_title = "Subtrees",
legend_title = "Annotation",
style = c("box", "violin"),
silent = FALSE,
...
)
Arguments
graphs |
list of igraph objects containing annotated lineage trees. |
field |
string defining the annotation field. |
stat |
string defining the subtree statistic to plot. One of:
|
root |
name of the root (germline) node. |
exclude |
vector of strings defining |
colors |
named vector of colors for values in |
main_title |
string specifying the plot title. |
legend_title |
string specifying the legend title. |
style |
string specifying the style of plot to draw. One of:
|
silent |
if |
... |
additional arguments to pass to ggplot2::theme. |
Value
A ggplot object defining the plot.
See Also
Subtree statistics are calculated with summarizeSubtrees.
Examples
# Define example tree set
graphs <- ExampleTrees[1:10]
# Violin plots of node outdegree by sample
plotSubtrees(graphs, "sample_id", "out", style="v")
# Violin plots of subtree size by sample
plotSubtrees(graphs, "sample_id", "size", style="v")
# Boxplot of node depth by isotype
plotSubtrees(graphs, "c_call", "depth", style="b")
Calculates the average polarity of amino acid sequences
Description
polar calculates the average polarity score of amino acid sequences.
Non-informative positions are excluded, where non-informative is defined as any
character in c("X", "-", ".", "*").
Usage
polar(seq, polarity = NULL)
Arguments
seq |
vector of strings containing amino acid sequences. |
polarity |
named numerical vector defining polarity scores for
each amino acid, where names are single-letter amino acid
character codes. If |
Value
A vector of bulkiness scores for the sequence(s).
References
Grantham R. Amino acid difference formula to help explain protein evolution. Science 185, 862-864 (1974).
See Also
For additional size related indices see aaindex.
Examples
# Default scale
seq <- c("CARDRSTPWRRGIASTTVRTSW", "XXTQMYVRT")
polar(seq)
# Use the Zimmerman et al, 1968 polarity scale from the seqinr package
library(seqinr)
data(aaindex)
x <- aaindex[["ZIMJ680103"]]$I
# Rename the score vector to use single-letter codes
names(x) <- translateStrings(names(x), ABBREV_AA)
# Calculate polarity
polar(seq, polarity=x)
Standard progress bar
Description
progressBar defines a common progress bar format.
Usage
progressBar(n)
Arguments
n |
maximum number of ticks |
Value
A progress_bar object.
Generate a clonal diversity index curve
Description
rarefyDiversity divides a set of clones by a group annotation,
resamples the sequences from each group, and calculates diversity
scores (D) over an interval of diversity orders (q).
Usage
rarefyDiversity(
data,
group,
clone = "CLONE",
copy = NULL,
min_q = 0,
max_q = 4,
step_q = 0.05,
min_n = 30,
max_n = NULL,
ci = 0.95,
nboot = 2000,
uniform = TRUE,
cell_id = "cell_id",
progress = FALSE
)
Arguments
data |
data.frame with Change-O style columns containing clonal assignments. |
group |
name of the |
clone |
name of the |
copy |
name of the |
min_q |
minimum value of |
max_q |
maximum value of |
step_q |
value by which to increment |
min_n |
minimum number of observations to sample. A group with less observations than the minimum is excluded. |
max_n |
maximum number of observations to sample. If |
ci |
confidence interval to calculate; the value must be between 0 and 1. |
nboot |
number of bootstrap realizations to generate. |
uniform |
if |
cell_id |
name of the |
progress |
if |
Details
Clonal diversity is calculated using the generalized diversity index (Hill numbers) proposed by Hill (Hill, 1973). See calcDiversity for further details.
Diversity is calculated on the estimated complete clonal abundance distribution. This distribution is inferred by using the Chao1 estimator to estimate the number of seen clones, and applying the relative abundance correction and unseen clone frequency described in Chao et al, 2015.
To generate a smooth curve, D is calculated for each value of q from
min_q to max_q incremented by step_q. When uniform=TRUE
variability in total sequence counts across unique values in the group column
is corrected by repeated resampling from the estimated complete clonal distribution to a
common number of sequences.
The diversity index (D) for each group is the mean value of over all resampling
realizations. Confidence intervals are derived using the standard deviation of the
resampling realizations, as described in Chao et al, 2015.
Value
A DiversityCurve object summarizing the diversity scores.
References
Hill M. Diversity and evenness: a unifying notation and its consequences. Ecology. 1973 54(2):427-32.
Chao A. Nonparametric Estimation of the Number of Classes in a Population. Scand J Stat. 1984 11, 265270.
Chao A, et al. Rarefaction and extrapolation with Hill numbers: A framework for sampling and estimation in species diversity studies. Ecol Monogr. 2014 84:45-67.
Chao A, et al. Unveiling the species-rank abundance distribution by generalizing the Good-Turing sample coverage theory. Ecology. 2015 96, 11891201.
See Also
Examples
## Not run:
# Group by sample identifier
div <- rarefyDiversity(ExampleDb, "sample_id", step_q=1, max_q=10, nboot=100)
plotDiversityCurve(div, legend_title="Sample")
# Grouping by isotype rather than sample identifier
div <- rarefyDiversity(ExampleDb, "c_call", min_n=40, step_q=1, max_q=10,
nboot=100)
plotDiversityCurve(div, legend_title="Isotype")
## End(Not run)
Read a Change-O tab-delimited database file
Description
readChangeoDb reads a tab-delimited database file created by a Change-O tool
into a data.frame.
Usage
readChangeoDb(file, select = NULL, drop = NULL, seq_upper = TRUE)
Arguments
file |
tab-delimited database file output by a Change-O tool. |
select |
columns to select from database file. |
drop |
columns to drop from database file. |
seq_upper |
if |
Value
A data.frame of the database file. Columns will be imported as is, except for the following columns which will be explicitly converted into character values:
SEQUENCE_ID
CLONE
SAMPLE
And the following sequence columns which will converted to upper case if
seq_upper=TRUE (default).
SEQUENCE_INPUT
SEQUENCE_VDJ
SEQUENCE_IMGT
JUNCTION
GERMLINE_IMGT
GERMLINE_IMGT_D_MASK
See Also
Wraps read_delim. See writeChangeoDb for writing to Change-O files. See read_rearrangement and write_rearrangement to read and write AIRR-C Standard formatted repertoires.
Examples
## Not run:
# Read all columns in and convert sequence fields to upper case
db <- readChangeoDb("changeo.tsv")
# Subset columns and convert sequence fields to upper case
db <- readChangeoDb("changeo.tsv", select=c("SEQUENCE_ID", "SEQUENCE_IMGT"))
# Drop columns and do not alter sequence field case
db <- readChangeoDb("changeo.tsv", drop=c("D_CALL", "DUPCOUNT"),
seq_upper=FALSE)
## End(Not run)
Load sequencing quality scores from a FASTQ file
Description
readFastqDb adds the sequencing quality scores to a data.frame
from a FASTQ file. Matching is done by 'sequence_id'.
Usage
readFastqDb(
data,
fastq_file,
quality_offset = -33,
header = c("presto", "asis"),
sequence_id = "sequence_id",
sequence = "sequence",
sequence_alignment = "sequence_alignment",
v_cigar = "v_cigar",
d_cigar = "d_cigar",
j_cigar = "j_cigar",
np1_length = "np1_length",
np2_length = "np2_length",
v_sequence_end = "v_sequence_end",
d_sequence_end = "d_sequence_end",
style = c("num", "ascii", "both"),
quality_sequence = FALSE
)
Arguments
data |
|
fastq_file |
path to the fastq file |
quality_offset |
offset value to be used by ape::read.fastq. It is the value to be added to the quality scores (the default -33 applies to the Sanger format and should work for most recent FASTQ files). |
header |
FASTQ file header format; one of |
sequence_id |
column in |
sequence |
column in |
sequence_alignment |
column in |
v_cigar |
column in |
d_cigar |
column in |
j_cigar |
column in |
np1_length |
column in |
np2_length |
column in |
v_sequence_end |
column in |
d_sequence_end |
column in |
style |
how the sequencing quality should be returned;
one of |
quality_sequence |
specify |
Value
Modified data with additional fields:
-
quality_alignment: A character vector with ASCII Phred scores forsequence_alignment. -
quality_alignment_num: A character vector, with comma separated numerical quality values for each position insequence_alignment. -
quality: A character vector with ASCII Phred scores forsequence. -
quality_num: A character vector, with comma separated numerical quality values for each position insequence.
See Also
maskPositionsByQuality and getPositionQuality
Examples
db <- airr::read_rearrangement(system.file("extdata", "example_quality.tsv", package="alakazam"))
fastq_file <- system.file("extdata", "example_quality.fastq", package="alakazam")
db <- readFastqDb(db, fastq_file, quality_offset=-33)
Read in output from IgPhyML
Description
readIgphyml reads output from the IgPhyML phylogenetics inference package for
B cell repertoires
Usage
readIgphyml(
file,
id = NULL,
format = c("graph", "phylo"),
collapse = FALSE,
branches = c("mutations", "distance")
)
Arguments
file |
IgPhyML output file (.tab). |
id |
ID to assign to output object. |
format |
if |
collapse |
if |
branches |
if |
Details
readIgphyml reads output from the IgPhyML repertoire phylogenetics inference package.
The resulting object is divided between parameter estimates (usually under the HLP19 model),
which provide information about mutation and selection pressure operating on the sequences.
Trees returned from this function are either igraph objects or phylo objects, and each may be visualized accordingly. Further, branch lengths in tree may represent either the expected number of substitutions per site (codon, if estimated under HLP or GY94 models), or the total number of expected substitutions per site. If the latter, internal nodes - but not tips - separated by branch lengths less than 0.1 are collapsed to simplify viewing.
Value
A list containing IgPhyML model parameters and estimated lineage trees.
Object attributes:
-
param: Data.frame of parameter estimates for each clonal lineage. Columns include:CLONE, which is the clone id;NSEQ, the total number of sequences in the lineage;NSITE, the number of codon sites;TREE_LENGTH, the sum of all branch lengths in the estimated lineage tree; andLHOOD, the log likelihood of the clone's sequences given the tree and parameters. Subsequent columns are parameter estimates from IgPhyML, which will depend on the model used. Parameter columns ending with_MLEare maximum likelihood estimates; those ending with_LCIare the lower 95 with_UCIare the upper 95 estimate. The first line ofparamis for cloneREPERTOIRE, which is a summary of all lineages within the repertoire. For this row,NSEQis the total number of sequences,NSITEis the average number of sites, andTREE_LENGTHis the mean tree length. For most applications, parameter values will be the same for all lineages within the repertoire, so access them simply by:<object>$param$OMEGA_CDR_MLE[1]to, for instance, get the estimate of dN/dS on the CDRs at the repertoire level. -
trees: List of tree objects estimated by IgPhyML. Ifformat="graph"these are igraphgraphobjects. Ifformat="phylo", these are apephyloobjects. -
command: Command used to run IgPhyML.
References
Hoehn KB, Lunter G, Pybus OG - A Phylogenetic Codon Substitution Model for Antibody Lineages. Genetics 2017 206(1):417-427 https://doi.org/10.1534/genetics.116.196303
Hoehn KB, Vander Heiden JA, Zhou JQ, Lunter G, Pybus OG, Kleinstein SHK - Repertoire-wide phylogenetic models of B cell molecular evolution reveal evolutionary signatures of aging and vaccination. bioRxiv 2019 https://doi.org/10.1101/558825
Examples
## Not run:
# Read in and plot a tree from an igphyml run
library(igraph)
s1 <- readIgphyml("IB+7d_lineages_gy.tsv_igphyml_stats_hlp.tab", id="+7d")
print(s1$param$OMEGA_CDR_MLE[1])
plot(s1$trees[[1]], layout=layout_as_tree, edge.label=E(s1$trees[[1]])$weight)
## End(Not run)
Calculate distance between two sequences
Description
seqDist calculates the distance between two DNA sequences.
Usage
seqDist(seq1, seq2, dist_mat = getDNAMatrix())
Arguments
seq1 |
character string containing a DNA sequence. |
seq2 |
character string containing a DNA sequence. |
dist_mat |
Character distance matrix. Defaults to a Hamming distance
matrix returned by getDNAMatrix. If gap
characters, |
Value
Numerical distance between seq1 and seq2.
See Also
Nucleotide distance matrix may be built with getDNAMatrix. Amino acid distance matrix may be built with getAAMatrix. Used by pairwiseDist for generating distance matrices. See seqEqual for testing sequence equivalence.
Examples
# Ungapped examples
seqDist("ATGGC", "ATGGG")
seqDist("ATGGC", "ATG??")
# Gaps will be treated as Ns with a gap=0 distance matrix
seqDist("ATGGC", "AT--C", dist_mat=getDNAMatrix(gap=0))
# Gaps will be treated as universally non-matching characters with gap=1
seqDist("ATGGC", "AT--C", dist_mat=getDNAMatrix(gap=1))
# Gaps of any length will be treated as single mismatches with a gap=-1 distance matrix
seqDist("ATGGC", "AT--C", dist_mat=getDNAMatrix(gap=-1))
# Gaps of equivalent run lengths are not counted as gaps
seqDist("ATG-C", "ATG-C", dist_mat=getDNAMatrix(gap=-1))
# Overlapping runs of gap characters are counted as a single gap
seqDist("ATG-C", "AT--C", dist_mat=getDNAMatrix(gap=-1))
seqDist("A-GGC", "AT--C", dist_mat=getDNAMatrix(gap=-1))
seqDist("AT--C", "AT--C", dist_mat=getDNAMatrix(gap=-1))
# Discontiguous runs of gap characters each count as separate gaps
seqDist("-TGGC", "AT--C", dist_mat=getDNAMatrix(gap=-1))
Test DNA sequences for equality.
Description
seqEqual checks if two DNA sequences are identical.
Usage
seqEqual(seq1, seq2, ignore = as.character(c("N", "-", ".", "?")))
Arguments
seq1 |
character string containing a DNA sequence. |
seq2 |
character string containing a DNA sequence. |
ignore |
vector of characters to ignore when testing for equality. Default is to ignore c("N",".","-","?") |
Value
Returns TRUE if sequences are equal and FALSE if they are not.
Sequences of unequal length will always return FALSE regardless of
their character values.
See Also
Used by pairwiseEqual within collapseDuplicates. See seqDist for calculation Hamming distances between sequences.
Examples
# Ignore gaps
seqEqual("ATG-C", "AT--C")
seqEqual("ATGGC", "ATGGN")
seqEqual("AT--T", "ATGGC")
# Ignore only Ns
seqEqual("ATG-C", "AT--C", ignore="N")
seqEqual("ATGGC", "ATGGN", ignore="N")
seqEqual("AT--T", "ATGGC", ignore="N")
Count or locate mismatches between sample and germline sequences
Description
seqMismatchCount counts Hamming-style mismatches between paired sample
and germline sequences, seqMismatchMatrix counts them between every
sample and every germline, and seqMismatchPositions returns the
mismatch positions of paired sequences.
Usage
seqMismatchCount(
samples,
germlines,
ignore = c("N", "-", ".", "?"),
count_trailing = FALSE
)
seqMismatchMatrix(
samples,
germlines,
ignore = c("N", "-", ".", "?"),
count_trailing = FALSE
)
seqMismatchPositions(
samples,
germlines,
ignore = c("N", "-", ".", "?"),
count_trailing = FALSE
)
Arguments
samples |
character vector of sample sequences. |
germlines |
character vector of germline sequences. For
|
ignore |
vector of characters to ignore, in either sequence.
Default is to ignore |
count_trailing |
if |
Details
Comparisons are case-insensitive. A missing (NA) sample or
germline gives NA.
Value
seqMismatchCount: an integer vector of mismatch counts.
seqMismatchMatrix: an integer matrix of mismatch counts, samples
in rows and germlines in columns.
seqMismatchPositions: a list of integer vectors of 1-based
mismatch positions.
Examples
seqMismatchCount(c("ATGGC", "ATGGN"), "ATGGC")
seqMismatchMatrix(c("ATGGC", "ATGGN"), c("ATGGC", "ATGGG"))
seqMismatchPositions("ATGGCA", "ATGG")
# A germline that ends early is not rewarded for it
seqMismatchMatrix("ATGGCA", c(full="ATGGCC", short="ATGG"))
seqMismatchMatrix("ATGGCA", c(full="ATGGCC", short="ATGG"), count_trailing=TRUE)
Sort V(D)J genes
Description
sortGenes sorts a vector of V(D)J gene names by either lexicographic ordering
or locus position.
Usage
sortGenes(genes, method = c("name", "position"))
Arguments
genes |
vector of strings representing V(D)J gene names. |
method |
string defining the method to use for sorting genes. One of:
|
Value
A sorted character vector of gene names.
See Also
See getAllele, getGene and getFamily for parsing
gene names.
Examples
# Create a list of allele names
genes <- c(
"IGHV1-69D*01", "IGHV1-69*01", "IGHV4-38-2*01", "IGHV1-69-2*01",
"IGHV2-5*01", "IGHV1-NL1*01", "IGHV1-2*01,IGHV1-2*05",
"IGHV1-2", "IGHV1-2*02", "IGHV1-69*02"
)
# Sort genes by name
sortGenes(genes)
# Sort genes by position in the locus
sortGenes(genes, method = "pos")
Weighted meta-analysis of p-values via Stouffer's method
Description
stoufferMeta combines multiple weighted p-values into a meta-analysis p-value
using Stouffer's Z-score method.
Usage
stoufferMeta(p, w = NULL)
Arguments
p |
numeric vector of p-values. |
w |
numeric vector of weights. |
Value
A named numeric vector with the combined Z-score and p-value in the form
c(Z, pvalue).
Examples
# Define p-value and weight vectors
p <- c(0.1, 0.05, 0.3)
w <- c(5, 10, 1)
# Unweighted
stoufferMeta(p)
# Weighted
stoufferMeta(p, w)
Generate subtree summary statistics for a tree
Description
summarizeSubtrees calculates summary statistics for each node of a tree. Includes
both node properties and subtree properties.
Usage
summarizeSubtrees(graph, fields = NULL, root = "Germline")
Arguments
graph |
igraph object containing an annotated lineage tree. |
fields |
annotation fields to add to the output. |
root |
name of the root (germline) node. |
Value
A data.frame with columns:
-
name: node name. -
parent: name of the parent node. -
outdegree: number of edges leading from the node. -
size: total number of nodes within the subtree rooted at the node. -
depth: the depth of the subtree that is rooted at the node. -
pathlength: the maximum pathlength beneath the node. -
outdegree_norm:outdegreenormalized by the total number of edges. -
size_norm:sizenormalized by the largest subtree size (the germline). -
depth_norm:depthnormalized by the largest subtree depth (the germline). -
pathlength_norm:pathlengthnormalized by the largest subtree pathlength (the germline).
An additional column corresponding to the value of field is added when
specified.
See Also
See buildPhylipLineage for generating input trees. See getPathLengths for calculating path length to nodes.
Examples
# Summarize a tree
graph <- ExampleTrees[[23]]
summarizeSubtrees(graph, fields="c_call", root="Germline")
Tabulate the number of edges between annotations within a lineage tree
Description
tableEdges creates a table of the total number of connections (edges) for each
unique pair of annotations within a tree over all nodes.
Usage
tableEdges(graph, field, indirect = FALSE, exclude = NULL)
Arguments
graph |
igraph object containing an annotated lineage tree. |
field |
string defining the annotation field to count. |
indirect |
if |
exclude |
vector of strings defining |
Value
A data.frame defining total annotation connections in the tree with columns:
-
parent: parent annotation -
child: child annotation -
count: count of edges for the parent-child relationship
See Also
See testEdges for performed a permutation test on edge relationships.
Examples
# Define example graph
graph <- ExampleTrees[[23]]
# Count direct edges between isotypes including inferred nodes
tableEdges(graph, "c_call")
# Count direct edges excluding edges to and from germline and inferred nodes
tableEdges(graph, "c_call", exclude=c("Germline", NA))
# Count indirect edges walking through germline and inferred nodes
tableEdges(graph, "c_call", indirect=TRUE, exclude=c("Germline", NA))
Pairwise test of the diversity index
Description
testDiversity performs pairwise significance tests of the diversity index
(D) at a given diversity order (q) for a set of annotation groups via
rarefaction and bootstrapping.
Usage
testDiversity(
data,
q,
group,
clone = "CLONE",
copy = NULL,
min_n = 30,
max_n = NULL,
nboot = 2000,
progress = FALSE,
ci = 0.95,
cell_id = "cell_id"
)
Arguments
data |
data.frame with Change-O style columns containing clonal assignments. |
q |
diversity order to test. |
group |
name of the |
clone |
name of the |
copy |
name of the |
min_n |
minimum number of observations to sample. A group with less observations than the minimum is excluded. |
max_n |
maximum number of observations to sample. If |
nboot |
number of bootstrap realizations to perform. |
progress |
if |
ci |
confidence interval to calculate; the value must be between 0 and 1. |
cell_id |
the name of the |
Details
Clonal diversity is calculated using the generalized diversity index proposed by Hill (Hill, 1973). See calcDiversity for further details.
Diversity is calculated on the estimated complete clonal abundance distribution. This distribution is inferred by using the Chao1 estimator to estimate the number of seen clones, and applying the relative abundance correction and unseen clone frequency described in Chao et al, 2014.
Variability in total sequence counts across unique values in the group column is
corrected by repeated resampling from the estimated complete clonal distribution to
a common number of sequences. The diversity index estimate (D) for each group is
the mean value of over all bootstrap realizations.
Significance of the difference in diversity index (D) between groups is tested by
constructing a bootstrap delta distribution for each pair of unique values in the
group column. The bootstrap delta distribution is built by subtracting the diversity
index Da in group-a from the corresponding value Db in group-b,
for all bootstrap realizations, yielding a distribution of nboot total deltas; where
group-a is the group with the greater mean D. The p-value for hypothesis
Da != Db is the value of P(0) from the empirical cumulative distribution
function of the bootstrap delta distribution, multiplied by 2 for the two-tailed correction.
Value
A DiversityCurve object containing slot test with p-values and summary statistics.
Note
This method may inflate statistical significance when clone sizes are uniformly small,
such as when most clones sizes are 1, sample size is small, and max_n is near
the total count of the smallest data group. Use caution when interpreting the results
in such cases. We are currently investigating this potential problem.
References
Hill M. Diversity and evenness: a unifying notation and its consequences. Ecology. 1973 54(2):427-32.
Chao A. Nonparametric Estimation of the Number of Classes in a Population. Scand J Stat. 1984 11, 265270.
Wu Y-CB, et al. Influence of seasonal exposure to grass pollen on local and peripheral blood IgE repertoires in patients with allergic rhinitis. J Allergy Clin Immunol. 2014 134(3):604-12.
Chao A, et al. Rarefaction and extrapolation with Hill numbers: A framework for sampling and estimation in species diversity studies. Ecol Monogr. 2014 84:45-67.
Chao A, et al. Unveiling the species-rank abundance distribution by generalizing the Good-Turing sample coverage theory. Ecology. 2015 96, 11891201.
See Also
Examples
## Not run:
# Groups under the size threshold are excluded and a warning message is issued.
testDiversity(ExampleDb, "sample_id", q=0, min_n=30, nboot=100)
## End(Not run)
Tests for parent-child annotation enrichment in lineage trees
Description
testEdges performs a permutation test on a set of lineage trees to determine
the significance of an annotation's association with parent-child relationships.
Usage
testEdges(
graphs,
field,
indirect = FALSE,
exclude = c("Germline", NA),
nperm = 200,
progress = FALSE
)
Arguments
graphs |
list of igraph objects with vertex annotations. |
field |
string defining the annotation field to permute. |
indirect |
if |
exclude |
vector of strings defining |
nperm |
number of permutations to perform. |
progress |
if |
Value
An EdgeTest object containing the test results and permutation realizations.
See Also
Uses tableEdges and permuteLabels. See plotEdgeTest for plotting the permutation distributions.
Examples
# Define example tree set
graphs <- ExampleTrees[1:10]
# Perform edge test on isotypes
x <- testEdges(graphs, "c_call", nperm=10)
print(x)
Tests for MRCA annotation enrichment in lineage trees
Description
testMRCA performs a permutation test on a set of lineage trees to determine
the significance of an annotation's association with the MRCA position of the lineage
trees.
Usage
testMRCA(
graphs,
field,
root = "Germline",
exclude = c("Germline", NA),
nperm = 200,
progress = FALSE
)
Arguments
graphs |
list of igraph object containing annotated lineage trees. |
field |
string defining the annotation field to test. |
root |
name of the root (germline) node. |
exclude |
vector of strings defining |
nperm |
number of permutations to perform. |
progress |
if |
Value
An MRCATest object containing the test results and permutation realizations.
See Also
Uses getMRCA and getPathLengths. See plotMRCATest for plotting the permutation distributions.
Examples
# Define example tree set
graphs <- ExampleTrees[1:10]
# Perform MRCA test on isotypes
x <- testMRCA(graphs, "c_call", nperm=10)
print(x)
Translate nucleotide sequences to amino acids
Description
translateDNA translates nucleotide sequences to amino acid sequences.
Usage
translateDNA(seq, trim = FALSE)
Arguments
seq |
vector of strings defining DNA sequence(s) to be converted to translated. |
trim |
boolean flag to remove 3 nts from both ends of seq (converts IMGT junction to CDR3 region). |
Value
A vector of translated sequence strings.
See Also
Examples
# Translate a single sequence
translateDNA("ACTGACTCGA")
# Translate a vector of sequences
translateDNA(ExampleDb$junction[1:3])
# Remove the first and last codon from the translation
translateDNA(ExampleDb$junction[1:3], trim=TRUE)
Translate a vector of strings
Description
translateStrings modifies a character vector by substituting one or more
strings with a replacement string.
Usage
translateStrings(strings, translation)
Arguments
strings |
vector of character strings to modify. |
translation |
named character vector or a list of character vectors specifying the strings to replace (values) and their replacements (names). |
Details
Does not perform partial replacements. Each translation value must match a complete
strings value or it will not be replaced. Values that do not have a replacement
named in the translation parameter will not be modified.
Replacement is accomplished using gsub.
Value
A modified strings vector.
See Also
See gsub for single value replacement in the base package.
Examples
# Using a vector translation
strings <- LETTERS[1:5]
translation <- c("POSITION1"="A", "POSITION5"="E")
translateStrings(strings, translation)
# Using a list translation
strings <- LETTERS[1:5]
translation <- list("1-3"=c("A","B","C"), "4-5"=c("D","E"))
translateStrings(strings, translation)
Write a Change-O tab-delimited database file
Description
writeChangeoDb is a simple wrapper around write_delim with defaults
appropriate for writing a Change-O tab-delimited database file from a data.frame.
Usage
writeChangeoDb(data, file)
Arguments
data |
data.frame of Change-O data. |
file |
output file name. |
See Also
Wraps write_delim. See readChangeoDb for reading to Change-O files. See read_rearrangement and write_rearrangement to read and write AIRR-C Standard formatted repertoires.
Examples
## Not run:
# Write a database
writeChangeoDb(data, "changeo.tsv")
## End(Not run)